Transcript asmbl_91593

Sequence
Transcript Sequence for observation asmbl_91593 of TGE0058721:
GGGCTGGCCTGGGAGGGAACCCGACTAGCAGAGCCCTCTGCTCAGTTGCTCCCAGCAGTGGCCCTGGGACCAGCTCTGCTCCTTGCACCCCGCTCCCTGCCTGGACACAGGCTCACTCGCTGCCTTCTTCTGGGGGAAACCAGCTTCTTGCCAGCCACAGCTGCTGCCTCCGCCACTGGCCACCGCCCCTGTCCTGGGAGTCCCTTGGCCCAGACACCCACCTGACTTAGTGGCTCCTCTGCAGGAAAGGTGGCTGCCCCCTGCGTTCCTCCATCCAACCATGAGCTGGTGCCCATCACCACTGAGAATGCACCAAAGAATGTAGTGGACAAGGGAGAAGGAGCCTCCCGGGGTGGAAACACACGGAAAAGCCTCGAGGACAACGGCTCCACCAGGGTCACCCCGAGTGTCCAGCCCCACCTCCAGCCCATCAGAAACATGAGTGTGAGCCGGACCATGGAGGACAGCTGTGAGCTGGACCTGGTGTACGTCACAGAGAGGATCATCGCTGTCTCCTTCCCCAGCACAGCCAATGAGGAGAACTTCCGGAGCAACCTCCGTGAGGTGGCGCAGATGCTCAAGTCCAAACATGGAGGCAACTACCTGCTGTTCAACCTCTCTGAGCGGAGACCTGACATCACGAAGCTCCATGCCAAGGTACTGGAATTTGGCTGGCCCGACCTCCACACCCCAGCCCTGGAGAAGATCTGCAGCATCTGTAAGGCCATGGACACATGGCTCAATGCAGACCCTCACAATGTCGTTGTTCTACACAACAAGGGAAACCGAGGCAGGATAGGAGTTGTCATCGCGGCTTACATGCACTACAGCAACATTTCTGCCAGTGCGGACCAGGCTCTGGACCGGTTTGCAATGAAGCGGTTCTATGAGGATAAGATTGTGCCCATTGGCCAGCCATCCCAAAGAAGGTACGTGCATTACTTCAGTGGCCTGCTCTCCGGCTCCATCAAAATGAACAACAAGCCCTTGTTTCTGCACCACGTGATCATGCACGGCATCCCCAACTTTGAGTCTAAAGGAGGATGTCGGCCATTTCTCCGCATCTACCAGGCCATGCAACCTGTGTACACATCTGGCATCTACAACATCCCAGGAGACAGCCAGACTAGCGTCTGCATCACCATCGAGCCAGGACTGCTCTTGAAGGGAGACATCTTGCTGAAGTGCTACCACAAGAAGTTCCGAAGCCCAGCCCGAGACGTCATCTTCCGTGTGCAGTTCCACACCTGTGCCATCCATGACCTGGGGGTTGTCTTTGGGAAGGAGGACCTTGATGATGCTTTCAAAGATGATCGATTTCCAGAGTATGGCAAAGTGGAGTTTGTATTTTCTTATGGGCCAGAGAAAATTCAAGGCATGGAGCACCTGGAGAACGGGCCGAGCGTGTCTGTGGACTATAACACCTCCGACCCCCTCATCCGCTGGGACTCCTACGACAACTTCAGTGGGCATCGAGATGACGGCATGGAGGAGGTGGTGGGACACACGCAGGGGCCACTAGATGGGAGCCTGTATGCTAAGGTGAAGAAGAAAGACTCCCTGCACGGCAGCACCGGGGCTGTTAATGCCACACGTCCTACACTGTCGGCCACCCCCAACCACGTGGAACACACGCTTTCTGTGAGCAGCGACTCGGGCAACTCCACAGCCTCCACCAAGACCGACAAGACCGACGAGCCTGTCCCCGGGGCCTCCAGTGCCACTGCTGCCTTGAGTCCCCAGGAGAAGCGGGAGCTGGACCGCCTGCTGAGTGGCTTTGGCTTAGAGCGAGAGAAGCAAGGCGCCATGTACCACACCCAGCACCTCAGGTCCCGCCCAGCAGGGGGCTCGGCTGTGCCCTCCTCTGGACGCCACGTTGTCCCAGCCCAGGTTCATGTCAATGGTGGGGCGTTAGCATCTGAGCGGGAGACAGACATCCTGGACGATGAATTGCCAAACCAGGATGGTCACAGTGCGGGCAGCATGGGCACACTCTCTTCTCTGGACGGGGTCACCAACACCAGTGAGGGGGGCTACCCAGAGGCCCTGTCCCCACTGACCAACGGTCTGGACAAGTCCTACCCCATGGAGCCTATGGTCAATGGAGGAGGCTACCCCTACGAGTCTGCCAGCCGGGCGGGGCCTGCCCATGCTGGCCACACGGCCCCCATGCGGCCCTCCTACTCTGCACAGGAGGGTTTAGCTGGCTACCAGAGGGAGGGGCCCCACCCAGCCTGGCCACAGCCAGTGACCACCTCCCACTATGCCCATGACCCCAGCGGTATGTTCCGCTCTCAATCCTTTTCGGAAGCTGAACCCCAGCTGCCCCCAGCTCCGGTCCGAGGGGGAAGCAGCCGGGAGGCTGTGCAAAGGGGACTGAATTCGTGGCAGCAGCAGCAGCAGCAGCAGC