Transcript asmbl_91590

Sequence
Transcript Sequence for observation asmbl_91590 of TGE0058722:
GCTGGAGGCAGCAGGGCGAGAGGCCCAGCAGATGCTGGCGGAGCCGGAGCAGCCGCGGACTCAGAGAGCCCTTCTGCCAGCGCCGCGGGGACTCTAGCTTCAGGGGCTCTTCACAGGCCCTGGGCGTGCCTCAGTGACGGGACCCAGCAAAGATGACGTGGATCTGTCTGTCCTGCATGCTCTGGCCAGAGGATCTGGAGGCCCCCAAGACACACCGCTTCAAGGTGAAGACCTTCAAGAAGGTGAAGCCCTGTGGGATCTGCCGCCAGGTCATCACCCAGGAAGGCTGCACCTGCAAAGTCTGCAGCTTCTCCTGTCATCGGAAATGCCAGGCCAAGCCATCCACCCACCCACCGCCAGCGTGCTCTTCCTCTGTGACCGATGTCTCCCGTGTAGCCATGAACCTGCATGCTCAGGATGCAGACGACGGTTTGGGAAGAGGGTGCGTGACTGCCGTGTGGGACTGCATGTCAGCTTCCCATGAAGGGGCACCTTGGGTGGCTGCCCCCTGCGTTCCTCCATCCAACCATGAGCTGGTGCCCATCACCACTGAGAATGCACCAAAGAATGTAGTGGACAAGGGAGAAGGAGCCTCCCGGGGTGGAAACACACGGAAAAGCCTCGAGGACAACGGCTCCACCAGGGTCACCCCGAGTGTCCAGCCCCACCTCCAGCCCATCAGAAACATGAGTGTGAGCCGGACCATGGAGGACAGCTGTGAGCTGGACCTGGTGTACGTCACAGAGAGGATCATCGCTGTCTCCTTCCCCAGCACAGCCAATGAGGAGAACTTCCGGAGCAACCTCCGTGAGGTGGCGCAGATGCTCAAGTCCAAACATGGAGGCAACTACCTGCTGTTCAACCTCTCTGAGCGGAGACCTGACATCACGAAGCTCCATGCCAAGGTACTGGAATTTGGCTGGCCCGACCTCCACACCCCAGCCCTGGAGAAGATCTGCAGCATCTGTAAGGCCATGGACACATGGCTCAATGCAGACCCTCACAATGTCGTTGTTCTACACAACAAGGGAAACCGAGGCAGGATAGGAGTTGTCATCGCGGCTTACATGCACTACAGCAACATTTCTGCCAGTGCGGACCAGGCTCTGGACCGGTTTGCAATGAAGCGGTTCTATGAGGATAAGATTGTGCCCATTGGCCAGCCATCCCAAAGAAGGTACGTGCATTACTTCAGTGGCCTGCTCTCCGGCTCCATCAAAATGAACAACAAGCCCTTGTTTCTGCACCACGTGATCATGCACGGCATCCCCAACTTTGAGTCTAAAGGAGGATGTCGGCCATTTCTCCGCATCTACCAGGCCATGCAACCTGTGTACACATCTGGCATCTACAACATCCCAGGAGACAGCCAGACTAGCGTCTGCATCACCATCGAGCCAGGACTGCTCTTGAAGGGAGACATCTTGCTGAAGTGCTACCACAAGAAGTTCCGAAGCCCAGCCCGAGACGTCATCTTCCGTGTGCAGTTCCACACCTGTGCCATCCATGACCTGGGGGTTGTCTTTGGGAAGGAGGACCTTGATGATGCTTTCAAAGATGATCGATTTCCAGAGTATGGCAAAGTGGAGTTTGTATTTTCTTATGGGCCAGAGAAAATTCAAGGCATGGAGCACCTGGAGAACGGGCCGAGCGTGTCTGTGGACTATAACACCTCCGACCCCCTCATCCGCTGGGACTCCTACGACAACTTCAGTGGGCATCGAGATGACGGCATGGAGGAGGTGGTGGGACACACGCAGGGGCCACTAGATGGGAGCCTGTATGCTAAGGTGAAGAAGAAAGACTCCCTGCACGGCAGCACCGGGGCTGTTAATGCCACACGTCCTACACTGTCGGCCACCCCCAACCACGTGGAACACACGCTTTCTGTGAGCAGCGACTCGGGCAACTCCACAGCCTCCACCAAGACCGACAAGACCGACGAGCCTGTCCCCGGGGCCTCCAGTGCCACTGCTGCCTTGAGTCCCCAGGAGAAGCGGGAGCTGGACCGCCTGCTGAGTGGCTTTGGCTTAGAGCGAGAGAAGCAAGGCGCCATGTACCACACCCAGCACCTCAGGTCCCGCCCAGCAGGGGGCTCGGCTGTGCCCTCCTCTGGACGCCACGTTGTCCCAGCCCAGGTTCATGTCAATGGTGGGGCGTTAGCATCTGAGCGGGAGACAGACATCCTGGACGATGAATTGCCAAACCAGGATGGTCACAGTGCGGGCAGCATGGGCACACTCTCTTCTCTGGACGGGGTCACCAACACCAGTGAGGGGGGCTACCCAGAGGCCCTGTCCCCACTGACCAACGGTCTGGACAAGTCCTACCCCATGGAGCCTATGGTCAATGGAGGAGGCTACCCCTACGAGTCTGCCAGCCGGGCGGGGCCTGCCCATGCTGGCCACACGGCCCCCATGCGGCCCTCCTACTCTGCACAGGAGGGTTTAGCTGGCTACCAGAGGGAGGGGCCCCACCCAGCCTGGCCACAGCCAGTGACCACCTCCCACTATGCCCATGACCCCAGCGGTATGTTCCGCTCTCAATCCTTTTCGGAAGCTGAACCCCAGCTGCCCCCAGCTCCGGTCCGAGGGGGAAGCAGCCGGGAGGCTGTGCAAAGGGGACTGAATTCGTGGCAGCAGCAGCAGCAGCAGCAGC