Transcript asmbl_91587

Sequence
Transcript Sequence for observation asmbl_91587 of TGE0058720:
AGCAGCAGCAGCAGCAGCAGCAGCCTCGCCCACCTCCACGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTTGTAGCCAGCAGGCCCAGCCCTCAGCCATTGGCAGAGACCCCCATCCCCAGTCTCCCTGAGTTCCCGCGAGCAGCCTCCCAGCAGGAGATTGAACAGTCCATCGAAACACTCAATATGCTGATGCTGGACCTGGAGCCAGCCTCCGCTGCTGCCCCACTACACAAGTCCCAGAGTGTCCCCGGGGCCTGGCCAGGGGCTTCTCCACTCTCCTCCCAGCCCCTCTCTGGATCCTCCCGTCAGTCCCATCCACTGACCCAGTCCAGATCTGGCTATATCCCCAGTGGGCATTCGTTGGGAACCCCTGAGCCAGCCCCACGGGCCTCTCTGGAGTCTGTCCCTCCTGGCAGGTCTTACTCACCTTATGACTATCAGCCATGTTTGGCTGGGCCTAACCAGGATTTCCATTCAAAGAGCCCAGCCTCTTCCTCCTTGCCTGCCTTCCTTCCGACCACCCACAGCCCTCCAGGGCCTCAGCAACCCCCAGCCTCTCTCCCTGGCCTCACTGCTCAGCCTCTGCTCTCACCAAAGGAAGCGACTTCAGACCCCTCCCGGACTCCAGAGGAGGAGCCATTGAATTTAGAAGGGCTGGTGGCCCACAGGGTAGCAGGGGTACAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCAGCCCCTCTGCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTCCAGAAGCCACATCCCCTCGTAGCCCTGGGGTTCGCTCCCCTGTCCAGTGTGTCTCCCCGGAGCTGGCTCTTACCATCGCTCTCAATCCTGGAGGGCGGCCCAAAGAGCCCCATTTGCACAGCTACAAGGAGGCCTTCGAGGAGATGGAGGGAACCTCCCCGAGCAGCCCACCACCCAGTGGGGTGCGGTCCCCCCCGGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCTCACAACCCAGCGGACATCCTGTTGCACCCCACAGGAGTTACCAGAAGACGGATCCAGCCAGAGCCCCGGAGCTATGTGGAGTCTGTGGCACGGACAGCGGTGGCTGGACCCCGAGCTCAGGACTCTGAGCCCAAGAGCTTTAGTGCTCCAGCCACCCAGGCCTATGGCCATGAGATACCCCTGAGGAACGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGTGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCGGGAGAGAGCAGTGACCAGGGTCCCCGGACGCCCACCCAGCCTCTGTTGGAGTCTGGCTTCCGCTCAGGCAGCCTGGGACAGCCCAGCCCGTCTGCCCAGAGAAACTACCAGAGCTCTTCTCCTCTCCCGACTGTGGGCAGTAGCTACAGCAGCCCCGACTACTCACTTCAGCATTTCAGCTCCTCTCCGGAAAGCCAGGCTCGAGCTCAGTTCAGTGTGGCTGGCGTCCACACGGTGCCTGGGAGCCCTCAGGCGCGCCACAGAACAGTGGGCACCAACACTCCCCCTAGTCCTGGCTTCGGCTGGCGGGCCATCAATCCCAGCATGGCTGCCCCCAGCAGTCCCAGTTTGAGCCATCACCAGATGATGGGTCCACCAGGCACTGGCTTCCATGGTAGCACTGTCTCCAGCCCCCAGAGCAGTGCAGCGACCACCCCGGGGAGCCCCAGCCTGTGTCGGCACCCAGCAGGGGTCTACCAGGTTTCTGGCCTCCACAACAAAGTGGCCACCACCCCGGGGAGTCCCAGCCTGGGCCGGCACCCTGGGGCTCACCAAGGCAACCTGGCCTCCGGTCTTCATAGCAATGCAATAGCCAGCCCTGGAAGCCCCAGCCTGGGCCGTCACCTCGGAGGGTCTGGATCTGTGGTTCCCGGCAGCCCCTGCTTGGACCGGCATGTGGCCTATGGTGGCTATTCTACCCCGGAGGATCGGAGACCCACACTGTCCCGGCAGAGCAGTGCCTCTGGCTACCAGGCTCCTTCCACGCCCTCCTTCCCTGTCTCCCCTGCCTACTACCCTGGCCTGAGCAGCCCTGCCACCTCCCCGTCACCAGACTCCGCAGCCTTCCGGCAAGGGAGCCCAACACCAGCCTTGCCAGAGAAGCGAAGGATGTCAGTGGGAGACCGGGCAGGCAGCCTCCCCAACTATGCCACCATCAATGGGAAGGTGTCTTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGGGCAGCACCGTCTCCTTCTCCCACACTCTGCCCGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCGGAGACGCGGGCTAAAGTGAAGTTTGTCCAGGACACTTCTAAGTATTGGTACAAGCCTGAGATCTCCAGGGAGCAGGCCATCGCGCTCCTCAAGGACCAGGAGCCGGGGGCCTTCATCATCCGCGACAGTCACTCCTTCCGAGGCGCGTACGGGCTGGCCATGAAGGTGTCTTCGCCACCTCCAACCATCATGCAGCAGAATAAAAAAGGAGACATGACCCATGAGCTGGTCAGGCATTTTCTGATAGAGACTGGCCCCAGAGGAGTCAAGCTCAAGGGCTGCCCCAATGAGCCAAACTTCGGATCGCTGTCTGCCCTGGTCTACCAGCACTCCATCATCCCATTGGCCCTGCCTTGCAAGCTGGTCATTCCAAACCGAGACCCCACAGATGAATCGAAAGATAGCTCCGGCCCTGCCAACTCAACTGCAGACCTGCTGAAACAAGGGGCAGCCTGCAATGTGCTCTTCGTCAACTCTGTGGACATGGAGTCACTCACTGGGCCACAGGCCATCTCTAAAGCCACATCTGAGACGTTGGCTGCAGACCCCACGCCAGCTGCCACCATCGTTCACTTCAAAGTCTCTGCCCAGGGAATCACTCTGACTGACAACCAGAGAAAGCTCTTTTTCAGACGCCACTACCCTCTCAACACTGTCACCTTCTGTGACCTGGATCCACAGGAAAGAAAGTGGATGAAAACAGAGGGTGGTGCCCCTGCTAAGCTCTTCGGCTTCGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTTGCTGAGCTTGACCCCAACCAGCCGGCCTCTGCCATCGTCAACTTCGTCTCCAAGGTCATGCTGAATGCCGGCCAAAAGAGATGAACCCTGCCCCTTGCCCAGGGCCAGTGCCATGGGGAAGGGGCTTGTGGGGAGGGGACCCATGAATCCTGACCACTCTTGAACCCAGAAGGAGGACTTTGGGCCAATTTCGGAGGAGAGAAGAAAGTGCAACGTGGGGAGAGGGAAGTGAATTGCAGAGGGGAGGGGGAAAAGAGAGAGAGAGAGAGAGAGA