Transcript asmbl_91586

Sequence
Transcript Sequence for observation asmbl_91586 of TGE0058719:
AGCAGCAGCAGCAGCAGCAGCAGCCTCGCCCACCTCCACGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTTGTAGCCAGCAGGCCCAGCCCTCAGCCATTGGCAGAGACCCCCATCCCCAGTCTCCCTGAGTTCCCGCGAGCAGCCTCCCAGCAGGAGATTGAACAGTCCATCGAAACACTCAATATGCTGATGCTGGACCTGGAGCCAGCCTCCGCTGCTGCCCCACTACACAAGTCCCAGAGTGTCCCCGGGGCCTGGCCAGGGGCTTCTCCACTCTCCTCCCAGCCCCTCTCTGGATCCTCCCGTCAGTCCCATCCACTGACCCAGTCCAGATCTGGCTATATCCCCAGTGGGCATTCGTTGGGAACCCCTGAGCCAGCCCCACGGGCCTCTCTGGAGTCTGTCCCTCCTGGCAGGTCTTACTCACCTTATGACTATCAGCCATGTTTGGCTGGGCCTAACCAGGATTTCCATTCAAAGAGCCCAGCCTCTTCCTCCTTGCCTGCCTTCCTTCCGACCACCCACAGCCCTCCAGGGCCTCAGCAACCCCCAGCCTCTCTCCCTGGCCTCACTGCTCAGCCTCTGCTCTCACCAAAGGAAGCGACTTCAGACCCCTCCCGGACTCCAGAGGAGGAGCCATTGAATTTAGAAGGGCTGGTGGCCCACAGGGTAGCAGGGGTACAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCAGCCCCTCTGCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTCCAGAAGCCACATCCCCTCGTAGCCCTGGGGTTCGCTCCCCTGTCCAGTGTGTCTCCCCGGAGCTGGCTCTTACCATCGCTCTCAATCCTGGAGGGCGGCCCAAAGAGCCCCATTTGCACAGCTACAAGGAGGCCTTCGAGGAGATGGAGGGAACCTCCCCGAGCAGCCCACCACCCAGTGGGGTGCGGTCCCCCCCGGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCTCACAACCCAGCGGACATCCTGTTGCACCCCACAGGAGAGCCCCGGAGCTATGTGGAGTCTGTGGCACGGACAGCGGTGGCTGGACCCCGAGCTCAGGACTCTGAGCCCAAGAGCTTTAGTGCTCCAGCCACCCAGGCCTATGGCCATGAGATACCCCTGAGGAACGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGTGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCGGGAGAGAGCAGTGACCAGGGTCCCCGGACGCCCACCCAGCCTCTGTTGGAGTCTGGCTTCCGCTCAGGCAGCCTGGGACAGCCCAGCCCGTCTGCCCAGAGAAACTACCAGAGCTCTTCTCCTCTCCCGACTGTGGGCAGTAGCTACAGCAGCCCCGACTACTCACTTCAGCATTTCAGCTCCTCTCCGGAAAGCCAGGCTCGAGCTCAGTTCAGTGTGGCTGGCGTCCACACGGTGCCTGGGAGCCCTCAGGCGCGCCACAGAACAGTGGGCACCAACACTCCCCCTAGTCCTGGCTTCGGCTGGCGGGCCATCAATCCCAGCATGGCTGCCCCCAGCAGTCCCAGTTTGAGCCATCACCAGATGATGGGTCCACCAGGCACTGGCTTCCATGGTAGCACTGTCTCCAGCCCCCAGAGCAGTGCAGCGACCACCCCGGGGAGCCCCAGCCTGTGTCGGCACCCAGCAGGGGTCTACCAGGTTTCTGGCCTCCACAACAAAGTGGCCACCACCCCGGGGAGTCCCAGCCTGGGCCGGCACCCTGGGGCTCACCAAGGCAACCTGGCCTCCGGTCTTCATAGCAATGCAATAGCCAGCCCTGGAAGCCCCAGCCTGGGCCGTCACCTCGGAGGGTCTGGATCTGTGGTTCCCGGCAGCCCCTGCTTGGACCGGCATGTGGCCTATGGTGGCTATTCTACCCCGGAGGATCGGAGACCCACACTGTCCCGGCAGAGCAGTGCCTCTGGCTACCAGGCTCCTTCCACGCCCTCCTTCCCTGTCTCCCCTGCCTACTACCCTGGCCTGAGCAGCCCTGCCACCTCCCCGTCACCAGACTCCGCAGCCTTCCGGCAAGGGAGCCCAACACCAGCCTTGCCAGAGAAGCGAAGGATGTCAGTGGGAGACCGGGCAGGCAGCCTCCCCAACTATGCCACCATCAATGGGAAGGTGTCTTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGGGCAGCACCGTCTCCTTCTCCCACACTCTGCCCGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCGGAGACGCGGGCTAAAGTGAAGTTTGTCCAGGACACTTCTAAGTATTGGTACAAGCCTGAGATCTCCAGGGAGCAGGCCATCGCGCTCCTCAAGGACCAGGAGCCGGGGGCCTTCATCATCCGCGACAGTCACTCCTTCCGAGGCGCGTACGGGCTGGCCATGAAGGTGTCTTCGCCACCTCCAACCATCATGCAGCAGAATAAAAAAGGAGACATGACCCATGAGCTGGTCAGGCATTTTCTGATAGAGACTGGCCCCAGAGGAGTCAAGCTCAAGGGCTGCCCCAATGAGCCAAACTTCGGATCGCTGTCTGCCCTGGTCTACCAGCACTCCATCATCCCATTGGCCCTGCCTTGCAAGCTGGTCATTCCAAACCGAGACCCCACAGATGAATCGAAAGATAGCTCCGGCCCTGCCAACTCAACTGCAGACCTGCTGAAACAAGGGGCAGCCTGCAATGTGCTCTTCGTCAACTCTGTGGACATGGAGTCACTCACTGGGCCACAGGCCATCTCTAAAGCCACATCTGAGACGTTGGCTGCAGACCCCACGCCAGCTGCCACCATCGTTCACTTCAAAGTCTCTGCCCAGGGAATCACTCTGACTGACAACCAGAGAAAGCTCTTTTTCAGACGCCACTACCCTCTCAACACTGTCACCTTCTGTGACCTGGATCCACAGGAAAGAAAGTGGATGAAAACAGAGGGTGGTGCCCCTGCTAAGCTCTTCGGCTTCGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTTGCTGAGCTTGACCCCAACCAGCCGGCCTCTGCCATCGTCAACTTCGTCTCCAAGGTCATGCTGAATGCCGGCCAAAAGAGATGAACCCTGCCCCTTGCCCAGGGCCAGTGCCATGGGGAAGGGGCTTGTGGGGAGGGGACCCATGAATCCTGACCACTCTTGAACCCAGAAGGAGGACTTTGGGCCAATTTCGGAGGAGAGAAGAAAGTGCAACGTGGGGAGAGGGAAGTGAATTGCAGAGGGGAGGGGGAAAAGAGAGAGAGAGAGAGAGAGA