Transcript asmbl_90577

Sequence
Transcript Sequence for observation asmbl_90577 of TGE0057814:
CCGCCTCCTCCCGACGCCGGCGCCGCTTTCTGGAAGGTTCGTGAAGGCAGTGAGGGCTTACCGTTATTACACTGCGGCCGGCCAGAATCCGGGTCCATCCGTCCTTCCCGAGCCAACCCAGACACAGCGGAGTTTGCCATGCCCGAGAATGTGGCACCCCGGAGCGGGGCGACTGCCGGGGCTGCCGGCGGCCGCGGGAAAGGCGCCTATCAGGACCGCGACAAGCCAGCCCAGATCCGCTTCAGCAACATTTCCGCCGCCAAAGCGGTTGCTGATGCTATTAGAACAAGCCTTGGACCAAAAGGAATGGATAAAATGATTCAAGATGGAAAAGGTGATGTAACCATTACAAATGATGGTGCTACCATTCTGAAACAAATGCAAGTATTACATCCAGCAGCCAGAATGCTGGTGGAGCTGTCTAAGGCTCAAGATATAGAAGCAGGAGATGGCACCACATCAGTAGTCATCATTGCTGGCTCCCTCTTAGATTCTTGTACCAAGCTTCTTCAGAAAGGGATTCATCCAACCATCATTTCTGAGTCATTCCAGAAGGCCCTGGAAAAGGGCATTGAAATCTTGACTGACATGTCTCGACCTGTGGAACTGAGTGACAGAGAAACTTTGTTAAATAGTGCAACCACTTCACTGAACTCAAAGGTGGTTTCTCAGTATTCAAGTCTGCTTTCTCCAATGAGTGTAAATGCAGTGATGAAAGTGATTGACCCAGCCACAGCCACCAGTGTAGATCTTAGAGATATTAAAATAGTTAAGAAGCTTGGTGGGACAATTGATGACTGTGAGTTGGTGGAAGGGCTGGTTCTCACCCAAAAAGTGTCAAATTCTGGCATAACCAGAGTTGAAAAGGCCAAGATTGGGCTTATTCAGTTTTGCTTATCTGCTCCCAAAACAGACATGGATAATCAAATAGTGGTTTCTGACTATGCCCAGATGGACCGAGTGCTGCGAGAAGAGAGAGCCTATATTTTAAATTTAGTGAAGCAAATTAAAAAAACAGGATGTAATGTCCTTCTCATACAGAAATCTATTCTAAGAGATGCTCTTAGTGATCTTGCATTACACTTTCTGAATAAAATGAAGATCATGGTGATTAAGGATATTGAAAGAGAAGACATTGAATTCATTTGTAAGACAATTGGAACCAAGCCAGTTGCTCATATTGACCAATTTACTGCTGACATGCTGGGTTCTGCTGAGTTAGCTGAGGAGGTCAATTTAAATGGTTCTGGCAAACTGCTCAAGATTACAGGCTGTGCCAGCCCTGGAAAAACAGTTACAATTGTTGTTCGTGGTTCTAACAAACTGGTGATTGAAGAAGCTGAGCGCTCCATTCATGATGCCCTATGTGTTATTCGTTGTTTAGTGAAGAAGAGGGCTCTTATTGCAGGAGGTGGTGCTCCAGAAATAGAGTTGGCCCTACGATTAACTGAATATTCACGAACACTGAGTGGTATGGAATCCTACTGCGTTCGTGCTTTTGCAGATGCTATGGAGGTCATTCCATCTACACTAGCTGAAAATGCCGGCCTGAATCCCATTTCTACAGTAACAGAACTAAGAAACCGGCATGCCCAGGGAGAAAAAACTGCAGGCATTAATGTCCGAAAGGGTGGTATTTCCAACATTTTGGAGGAACTGGTTGTCCAGCCTCTGTTGGTATCAGTCAGTGCTCTGACTCTTGCAACTGAAACTGTTCGGAGCATTCTGAAAATAGATGATGTGGTAAACACTCGATAATCTGGATAACTGACTAGCACCATTATGATCACCAGTATTGTGGCTGGAATGGAAGAAGATCACCTTGGTGTTCCTTGTTTGGAAGATTATTTCCTCTGAATTTCTGGGCTTGGTCTTCCAGTTGGCATTTGCCTGAAGTTGTATTGAAACAATTTAATGAAAATATTAAATATTTGGTTTCAAAAGGCAGATTTATCTTCTCCCAACATTCTGTTATTTCTGATACTTTTGAAAAACTAATAAAAACTAATAAAAGAAGCGTAAAAAGTGAGTTTACATGTTGAGGAAAAAAATGGCCCAATATGCTCATCACTGATAAATGCTCCCTGGCCTTAAAAACTACCAACATATAATATATATGCTGTCTTAAAAGTTAATGATCCAAGTGGCACCTCTCTGAACCTACTTTGGCTTGGGAGGCTGCCCAGTTAAAACAAAAATAAGTTAATGGTACAGAAAGAGAATGAAAAATGAAAGCCTCCTTTTATCCTATCATCCTAATTCCTTTTCCCAG