Transcript asmbl_90550

Sequence
Transcript Sequence for observation asmbl_90550 of TGE0058718:
CTCCCTTTCTCCTCCTCCTCCTGCCGCCGCGGCCGCTGCCGGACTTCGCCAGATCAGACCCACGGGGCTGCCCTCCCCTGCGCACTCCCCTCGCTGCCCGGGCCCGGAGCGCAGCGCGGCCGCACAGGTATTTTTGCTGTGCTGTGCAAGGAACTCTGCTAGCTCAAGATTCACAATGTTGAAAGCCCTTTTCCTAACTATGCTGACTCTGGCGCTGGTCAAGTCACAGGACACCGAAGAAACCATCACGTACACGCAATGCACTGACGGATATGAGTGGGATCCTGTGAGACAGCAATGCAAAGATATTGATGAATGTGACATTGTCCCAGACGCTTGTAAAGGTGGAATGAAGTGTGTCAACCACTATGGAGGATACCTCTGCCTTCCGAAAACAGCCCAGATTATTGTCAATAATGAACAGCCTCAGCAGGAAACACAACCAGCAGAAGGAACCTCAGGGGCAACCACCGGGGTTGTAGCTGCCAGCAGCATGGCAACCAGTGGAGTGTTGCCCGGGGGTGGTTTTGTGGCCAGTGCTGCTGCAGTCGCAGGCCCTGAAATGCAGACTGGCCGAAATAACTTTGTCATCCGGCGGAACCCAGCTGACCCTCAGCGCATTCCCTCCAACCCTTCCCACCGTATCCAGTGTGCAGCAGGCTACGAGCAAAGTGAACACAACGTGTGCCAAGACATAGACGAGTGCACTGCAGGGACGCACAACTGTAGAGCAGACCAAGTGTGCATCAATTTACGGGGATCCTTTGCATGTCAGTGCCCTCCTGGATATCAGAAGCGAGGGGAGCAGTGCGTAGACATAGATGAATGTACCATCCCTCCATATTGCCACCAAAGATGCGTGAATACACCAGGCTCATTTTATTGCCAGTGCAGTCCTGGGTTTCAATTGGCAGCAAACAACTATACCTGCGTAGATATAAATGAATGTGATGCCAGCAATCAATGTGCTCAGCAGTGCTACAACATTCTTGGTTCATTCATCTGTCAGTGCAATCAAGGATATGAGCTAAGCAGTGACAGGCTCAACTGTGAAGACATTGATGAATGCAGAACCTCAAGCTACCTGTGTCAATATCAATGTGTCAATGAACCTGGGAAATTCTCATGTATGTGCCCCCAGGGATACCAAGTGGTGAGAAGTAGAACATGTCAAGATATAAATGAGTGTGAGACCACAAATGAATGCCGGGAGGATGAAATGTGTTGGAATTATCATGGCGGCTTCCGTTGTTATCCACGAAATCCTTGTCAAGATCCCTACATTCTAACACCAGAGAACCGATGTGTTTGCCCAGTCTCAAATGCCATGTGCCGAGAACTGCCCCAGTCAATAGTCTACAAATACATGAGCATCCGATCTGATAGGTCTGTGCCATCAGACATCTTCCAGATACAGGCCACAACTATTTATGCCAACACCATCAATACTTTTCGGATTAAATCTGGAAATGAAAATGGAGAGTTCTACCTACGACAAACAAGTCCTGTAAGTGCAATGCTTGTGCTCGTGAAGTCATTATCAGGACCAAGAGAACATATCGTGGACCTGGAGATGCTGACAGTCAGCAGTATAGGGACCTTCCGCACAAGCTCTGTGTTAAGATTGACAATAATAGTGGGGCCATTTTCATTTTAGTCTTTTCTAAGAGTCAACCACAGGCATTTAAGTCAGCCAAAGAATATTGTTACCTTAAAGCACTATTTTATTTATAGATATATCTAGTGCATCTACATCTCTATACTGTACACTCACCCATAATTCAAACAATTACACCATGGTATAAAGTGGGCATTTAATATGTAAAGATTCAAAGTTTGTCTTTATTACTATATGTAAATTAGACATTAATCCACTAAACTGGTCTTCTTCAAGAGAGCTAAGTATACACTATCTGGTGAAACTTGGATTCTTTCCTATAAAAGTGGGACCAAGCAATGATGATCTTCTGTGGTGCTTAAGGAAACTTACTAGAGCTCCACTAACAGTCTCATAAGGAGGCAGCCATCATAACCATTGAATAGCATGCAAGGGTAAGAATGAGTTTTTAACTGCTTTGTAAGAAAATGGAAAAGGTCAATAAAGATATATTTCTTTAGAAAATGGGGATCTGCCATATTTGTGTTGGTTTTTATTTTCATATCCAGCCTAAAGGTGGTTGTTTATTATATAGTAATAAATCATTGCTGTACAATATGCTGGTTTCTGTAGGGTATTTTTAATTTTGTCAGAAATTTTAGATTGTGAATATTTTGTAAAAAACAGTAAGCAAAATTTTCCAGAATTCCCAAAATGAACCAGATATCCCCTAGAAAATTATACTATTGAGAAATCTATGGGGAGGATATGAGAAAATAAATTCCTTCTAAACCACATTGGAACTGACCTGAAGAAGCAAACTCGGAAAATATAATAACATCCCTGAATTCAGGACTTCCACAAGATGCAGAACAAAATGGATAAAAGGTATTTCACTGGAGAAGTTTTAATTTCTAAGTAAAATTTAAATCCTAACACTTCACTAATTTATAACTAAAATTTCTCATCTTCGTACTTGATGCTCACAGAGGAAGAAAATGATGATGGTTTTTATTCCTGGCATCCAGAGTGACAGTGAACTTAAGCAAATTACCCTCCTACCCAATTCTATGGAATATTTTATACGTCTCCTTGTTTAAAATGTCACTGCTTTACTTTGATGTATCATATTTTTAAATAAAAATAAATATTCCTTTAGAAGATCA