Transcript asmbl_90509

Sequence
Transcript Sequence for observation asmbl_90509 of TGE0058716:
GTGTTTATGAGGCGCTGGGGGCGGAGGAGGCGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGTTAGCTTTGTACATAGCATCTCACTTTGCACAACAACCCTGCAAGGCTGACCAACTGACTGAAGAGCAGATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAAGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTAGATGCTGATGGTAATGGCACAATTGACTTCCCTGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGATAAGGATGGCAATGGCTATATTAGTGCTGCAGAACTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAAGTTGATGAAATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACCTTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTCTTTGTTTGTAACTTATCTGTAAAAGGTTTCTCCCTACTGTCAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTATCTTACTGTCATTGTCCTAAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGATGGAGTTGGTCAAATGAGGGAACATCTGGGTTATGCCTTTTTTAAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCAACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTGCTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAATCTGCTTATGGCACAATTTGCCTCAAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAATTACAATTTACCCAATGGTTGCTCTGCATCTGAGTCATTTAACTGTTGAAGTCTAATAATTTTGAAAATAAAATATGGCATTGGTTTCTGCTTGG