Transcript asmbl_90508

Sequence
Transcript Sequence for observation asmbl_90508 of TGE0000391:
GTGTTTATGAGGCGCTGGGGGCGGAGGAGGCGAATTAGTCCGAGTGGAGAGAGCGAGCTGAGTGGTTGTGTGGTCGCGTCTCGGAAACCGGTAGCGCTTGCAGCATGGCTGACCAACTGACTGAAGAGCAGATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAAGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTAGATGCTGATGGTAATGGCACAATTGACTTCCCTGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGATAAGGATGGCAATGGCTATATTAGTGCTGCAGAACTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAAGTTGATGAAATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACCTTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTCTTTGTTTGTAACTTATCTGTAAAAGGTTTCTCCCTACTGTCAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTATCTTACTGTCATTGTCCTAAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGATGGAGTTGGTCAAATGAGGGAACATCTGGGTTATGCCTTTTTTAAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCAACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTGCTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAATCTGCTTATGGCACAATTTGCCTCAAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAATTACAATTTACCCAATGGTTGCTCTGCATCTGAGTCATTTAACTGTTGAAGTCTAATAATTTTGAAAATAAAATATGGCATTGGTTTCTGCTTGG