Transcript asmbl_90344

Sequence
Transcript Sequence for observation asmbl_90344 of TGE0056843:
ATACGACCTTTCGGCCATGTTAGCCAGGAGCGAGGGGCAGGGCTAAGGGGCCGGCGGCCACTCGGCATCTGGGTTTTAGTCAGGCAGTGCTCCAGGCGCCTGGCTGCCAGGCTACGGGAGAAAAGTCCTCCGCTCGGCCGCACCCGTTAGAGGCGCTCTCCACTGCTGTCCTCTTCAGCTCAAGATGGTGGCCTGCCGGGCGATTGGCATCCTCAGCCGCTTTTCTGCCTTCAGGATCCTCCGCTCCCGAGGTTATATATGCCGCAATTTTACAGGGTCTTCTGCTTTGCTGACCAGAACCCATATTAACTATGGAGTCAAAGGGGATGTGGCAGTTGTTCGAATTAACTCTCCCAATTCAAAGGTAAATACACTGAGTAAAGAGCTACATTCAGAGTTCTCAGAAGTTATGAATGAAATCTGGGCTAGTGATCAAATCAGAAGTGCCGTCCTTATCTCATCAAAGCCAGGCTGCTTTATTGCAGGTGCTGATATCAACATGTTAGCCGCTTGCAAGACCCTTCAAGAAGTAACACAGCTATCACAAGAAGCACAGAGAATAGTTGAGAAACTTGAAAAGTCCACAAAGCCTATTGTGGCTGCCATCAATGGATCCTGCCTGGGAGGAGGACTTGAGGTTGCCATTTCATGCCAATACAGAATAGCAACAAAAGACAGAAAAACAGTATTAGGTACCCCTGAAGTTTTGCTGGGGGCCTTACCAGGAGCAGGAGGCACACAAAGGCTGCCCAAAATGGTGGGTGTGCCTGCTGCTTTGGACATGATGCTGACTGGTAGAAGCATTCGTGCAGACAGGGCAAAGAAAATGGGACTGGTTGACCAACTGGTGGAACCCCTGGGACCAGGACTAAAACCTCCAGAGGAACGGACAATAGAATACCTAGAAGAAGTTGCAATTACTTTTGCCAAAGGACTAGCTGATAAGAAGATCTCTCCAAAGAGAGACAAGGGATTGGTGGAAAAATTGACAGCGTATGCCATGACTATTCCATTTGTCAGGCAACAGGTTTACAAAAAAGTGGAAGAAAAAGTGCGAAAGCAGACTAAAGGCCTTTATCCTGCACCTCTGAAAATAATTGATGTGGTAAAGACTGGAATTGAGCAAGGGAGTGATGCCGGTTATCTCTGTGAATCTCAGAAATTTGGAGAGCTTGTAATGACCAAAGAATCAAAGGCCTTGATGGGACTCTACCATGGTCAGGTCCTGTGCAAGAAGAATAAATTTGGAGCTCCACAGAAGGATGTTAAGCATCTGGCTATTCTTGGTGCAGGGCTGATGGGAGCAGGCATCGCCCAAGTCTCCGTGGATAAGGGGCTAAAGACTATACTTAAAGATGCCACCCTCACTGCGCTAGACCGAGGACAGCAACAAGTGTTCAAAGGATTGAATGACAAAGTGAAGAAGAAAGCTCTAACATCATTTGAAAGGGATTCCATCTTCAGCAACTTGACTGGGCAGCTTGATTACCAAGGTTTTGAAAAGGCCGACATGGTGATTGAAGCTGTGTTTGAGGACCTTAGTCTTAAGCACAGAGTGCTAAAGGAAGTAGAAGCGGTGATTCCAGATCACTGTATCTTTGCCAGTAACACATCTGCTCTCCCAATCAGTGAAATCGCTGCTGTCAGCAAAAGACCTGAGAAGGTGATTGGCATGCACTACTTCTCTCCCGTGGACAAGATGCAGCTGCTGGAGATTATCACGACCGAGAAAACTTCCAAAGACACCAGTGCTTCAGCTGTAGCAGTTGGTCTCAAGCAGGGGAAGGTCATCATTGTGGTTAAGGATGGACCTGGCTTCTATACTACCAGGTGTCTTGCGCCCATGATGTCTGAAGTCATCCGAATCCTCCAGGAAGGAGTTGACCCGAAGAAGCTGGATTCCCTGACCACAAGCTTTGGCTTTCCTGTGGGTGCCGCCACACTGGTGGATGAAGTTGGTGTGGATGTAGCGAAACATGTGGCGGAAGATCTGGGCAAAGTCTTTGGGGAGCGGTTTGGAGGTGGAAACCCAGAACTGCTGACACAGATGGTGTCCAAGGGCTTCCTAGGTCGTAAATCTGGGAAGGGCTTTTACATCTATCAGGAGGGTGTGAAGAGGAAGGATTTGAATTCTGACATGGATAGTATTTTAGCGAGTCTGAAGCTGCCTCCTAAGTCTGAAGTCTCATCAGACGAAGACATCCAGTTCCGCCTGGTGACAAGATTTGTGAATGAGGCAGTCATGTGCCTGCAAGAGGGGATCTTGGCCACACCTGCAGAGGGAGACATCGGAGCCGTCTTTGGGCTTGGCTTCCCGCCTTGTCTGGGAGGGCCTTTCCGCTTTGTGGATCTGTATGGCGCCCAGAAGATAGTGGACCGGCTCAAGAAATATGAAGCTGCCTATGGAAAACAGTTCACCCCATGCCAGCTGCTAGCTGACCATGCTAACAGCCCTAACAAGAAGTTCTACCAGTGAGCAGGCCTCATGCCTCGCTCAGTCAGTGCACTAACCCCAGCTGCCGGCAGTGCTGGTTCTCCAACAGAGTGGTGTCTAGATTTATCAGAGTAACGAGAAGACAAACTCCGGCACTGGGTTTGCTCCCTGATTAAAGTGCCTTCAGCCAAGACCATCTCTCCCTCCTGGTGAAGTGTGACTTCGAATTAGTTTGCACTTCCTGTTGGAAGGTAGAGCCCACTGCTCATTGTATAAGCCCCGAGGCCTAGAGTGGCAGCCAAGAGCCATCTGAAGCCACCTCTCTGCCTGTTCCTCCCAAGAGGCCAGGGTGGCCAGGGGTGGTGAGGGCAGTTCTGCACCCAGCCAAACACATAACAATAAAAACCAAACTCTGTGTCAGCATCTTTGCCCTTCTGGTTTAAACGCCTCCTTCAAAAAGCAATCTGGAAGAAAGCCCTGTGCTTTGGGGGAGTAAGAATGTGTGTGCAGAATTCTAGGCAGCACCTTAGGGAGGGACTGGGATGAGAGAAAGTGGGACCTGGTGGGCTCAACCACACACACCTGTCTGTGCAGATGCTTTGCCCAGGCTTCTCACCACGGTGTACCGGGATATTAAACCTCTTTCCCCA