Transcript asmbl_90152

Sequence
Transcript Sequence for observation asmbl_90152 of TGE0058714:
AGCGGTGGGAGGACTGCGGGGCTCTTGAGGCCAGCTGCAGAGCTTGTGGAGGCCATGGGGCGCGTCGTCGCGGAGCTCGTCTCCTCGCTGCTGGGGTTGTGGCTGTTGCTGTGCAGCTGCGGATGCCCCGAGGGCGCCGAGCTGCGTGCTCCGCCAGATAAAATCGCGATTATTGGAGCCGGAATTGGTGGCACTTCAGCAGCCTATTACCTGCGGCAGAAATTTGGGAAAGATGTGAAGATAGACCTGTTTGAAAGAGAAGAGGTCGGGGGCCGCCTGGCTACCATGATGGTGCAGGGGCAAGAATACGAGGCAGGAGGTTCTGTCATCCATCCTTTAAATCTGCACATGAAACGTTTTGTCAAAGACCTGGGTCTCTCTGCTGTTCAGGCCTCTGGTGGCCTACTGGGGATATATAATGGAGAGACTCTGGTATTTGAGGAGAGCAACTGGTTCATAATTAACGTGATTAAATTAGTTTGGCGCTATGGATTTCAATCCCTCCGTATGCACATGTGGGTAGAGGACGTGTTAGACAAGTTCATGAGGATCTACCGCTACCAGTCTCATGACTATGCCTTCAGTAGTGTCGAAAAATTACTTCATGCTCTAGGAGGAGATGACTTCCTTGGAATGCTTAATCGAACACTTCTTGAAACCTTGCAAAAGGCCGGCTTTTCTGAGAAGTTCCTCAATGAAATGATTGCTCCTGTTATGAGGGTCAATTATGGCCAAAGCACGGACATCAATGCCTTTGTGGGGGCGGTGTCACTGTCCTGTTCTGATTCTGGCCTTTGGGCAGTAGAAGGTGGCAATAAACTTGTTTGCTCAGGGCTTCTGCAGGCATCCAAAAGCAATCTTATATCTGGCTCAGTAATGTACATCGAGGAGAAAACAAAGACCAAGTACACAGGAAATCCAACAAAGATGTATGAAGTGGTCTACCAAATTGGAACTGAGACTCGTTCAGACTTCTATGACATCGTCTTGGTGGCCACTCCGTTGAATCGAAAAATGTCGAATATTACTTTTCTCAACTTTGATCCTCCAATTGAGGAATTCCATCAATATTATCAACATATAGTGACAACTTTAGTTAAGGGGGAATTGAATACATCTATCTTTAGCTCTAGACCCATAGATAAATTTGGCCTTAATACAGTTTTAACCACTGATAATTCAGATTTGTTCATTAACAGTATTGGGATTGTGCCCTCTGTGAGAGAAAAGGAAGATCCTGAGCCATCAACAGATGGAACATATGTTTGGAAGATCTTTTCCCAAGAAACTCTTACTAAAGCACAAATTTTAAAGCTCTTTCTGTCCTATGATTATGCTGTGAAGAAGCCATGGCTTGCATATCCTCACTATAAGCCCCCGGAGAAATGCCCCTCTATCATTCTCCATGATCGACTTTATTACCTCAATGGCATAGAGTGTGCAGCAAGTGCCATGGAGATGAGTGCCATTGCAGCCCACAACGCTGCACTCCTTGCCTATCACCGCTGGAACGGGCACACAGACATGATTGATCAGGATGGCTTATATGAGAAACTTAAAACTGAACTATGAAGTGACACACTCCTTTTTCCCCTCCTAGTTCCAAATGACTATCAGTGGCAAAAAAGAACAAAATCTGAGCAGAGATGATTTTGAACCAGATATTTTGCCATTATCATTGTTTAATAAAAGTAATCCCTGCTGGTCATAGGAAAACACACGGTTCTAATTAAGTGTGAAGGTATAGCTATTGCACTTATGCCATCTCCAAAATTTCTTAAGTATTCTTTCACTATCCATTAGGAGTTTTTCTTAAACTTGTCTGATAATAAGAATCACCTGGAGTTAGGAGGTGGTGGTTGCAGTGAGCCAATCTCACCATTGCACTTCAGCCTGAGCAACACGAGCAAAACTCCGTCTCAAAAGTAAATAAAAATAATCACCTGGAGTTTGTTAAACCATATGGATTCTCAAGCTCCTCTCTTGAAGATTCTGATTCAGTAGGTCTGGGAGTGGCGCGCTGGATTTTGATCAAAATTGTAGAGCATTTTAAGGTGAGTACCTGAGGGAGAACTTAAAGACATCTTAGTTGGGGAGTAGTCCTTTTGAATTTTACAGCTAGATATAATCTTCAGTCAGATAAAATTTATGGGAGCTGGTGTCTTATGCCTGACTCTTAGTAATTTCATACCGGTTTGAAGTACGTGTGCCCATGCCTAAAGCCTTGACTTTCAGAATGTTGTCTTTTGATTCTTCTGTCTTGATTTGATTAGGGGTGAAATTTAGAAGTCTTAGTAATGTAACTTGAAGATGTTAAACAAAAATCTCAAGTAAAATGAAAAGCAAATATGGGCTACTGAATTAAGAAACTGGCATTCTAGTATTAAATCCTCACTTCAGGAGCTTTTAAAAATACTGAGACCCCCCCATAACCAGAGATTCAGATTCAAAGACTGAGGATAGGACCTTAGCATTGTAGCTATTTAAAGTTTCTAATGTGCACCCAGGGTTGGGAATCACCAATGTGGGTGTGAAAATGCCTACAAAGGGTTTTAGTGCCTTAGAAGTCCTAAGAAGCCCAATCTGTATCAAAGCAGATCCATTTTGCAAGGATCTTTCTTTTAGAACTTTCTCAGTTCTCTTAGTAAGAACTTTAGAAGTAATCTTGATAATAAGCACAGACAGCCTAACAGCAGAGGCAACTTAAATAACTCCTGAGCAGTTGGCACTAGAACAGAATACTTGGAATGACACCAAAGTTAACCAAGTCCAGCATATGTCCAAAGAGTTAAGTGTTTCATTTACTGTAGCATTCTGGGTGAGAAATTGGTTGCTGAAATCTTAAGACAGTGGTCTCAACCTTGGCTGCACATTGGAATCACCTGTAGGGTTTTAAAGCATCCAAATGGTAATTAACAGGCAGCAAAACTTCAGAACTAGTTCTGCATCTACTGTGCAAAGATCATGATTAACTGTCAAGACACTGGTAGAACAGAACAAGCAAAAGATTAAGAGTTCAAAAGTAAATGCAACCAATTTAACATGTAGTGTTATTAAAAAATTACAAAGGCCTAGACCAGCCTGGGCAACATGGTGAAACCCCATCTCTACAAAAA