Transcript asmbl_89872

Sequence
Transcript Sequence for observation asmbl_89872 of TGE0056297:
GGTGCGCTTCCTGGAGCAGCAGAACGCGGCGCTCGCCGCCGAAGTGAACCGGCTCAAGGGCCGCGAGCCGACGCGAGTGGCCGAGCTCTACGAGGAGGAGCTGCGGGAGCTGCGGCGCCAGGTGGAGGTGCTCACTAACCAGCGCGCGCGCGTCGACGTCGAGCGCGACAACCTGCTCGACGACCTGCAGCGGCTCAAGGCCAAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGCAGATGCGGGAATTGGAGGACCGATTTGCCAGTGAGGCCAGTGGCTACCAGGACAACATTGCGCGCCTGGAGGAGGAAATCCGGCACCTCAAGGATGAGATGGCCCGCCATCTGCGCGAGTACCAGGACCTGCTCAACGTGAAGATGGCCCTGGATGTGGAGATTGCCACCTACCGGAAGCTGCTGGAGGGAGAGGAGAGCCGGATCAATCTCCCCATCCAGACCTACTCTGCCCTCAACTTCCGAGAAACCAGCCCTGAGCAAAGGGGTTCTGAGGTCCATACCAAGAAGACGGTGATGATCAAGACCATCGAGACACGGGATGGGGAGGTCGTCAGTGAGGCCACACAGCAGCAGCATGAAGTGCTCTAAAGACAGAGACCCTCTGCCACCAGAGACCGTCCTCACCCCTGTCCTCACTGCTCCCTGAAGCCAGCCTTCTTCCATCCCAGGACACCACACCCAGCCTCAGTCCTCCCCTCACAGCCTCTGACCCCTCCTCACTGGCCATCCCTCGTGGTCCCCAACAGCGACATAGCCCATCCCTGCCTGGTCACAGGGCATGCCCCGGCCACCTCTGCGGACCCCAGCTGTGAGCCTTGGCTGTTGGCAGTGAGTGAGCCTGGCTCTTGTGCTGGATGGAGCCCAGGCGGGAGCGGTGGCCCTGTCCCTCCCACCTCTGTGACCTCAGGCACTAGCCTTTGGCTCTGGAGACAGCCCCAGAGCAGGGTGTTGGGATACTGCAGGGCCAGGACTGAGCCCCGCAGACCTCCCCAGCCCCTAGCCCAGGAGAGAGAAAGCCAGGCAGGTAGCCAGGGGGACTAGCCCCTGTGGAGACTGGGGGGCTTGAAATTGTCCCCGTGGTCTCTTACTTTCCTTTCCCCAGCCCAGGGTGGACTTAGAAAGCAGGGGCTACAAGAGGGAATCCCCGAAGGTGCTGGAGGTGGGAGCAGGAGATTGAGAAGGAGAGAAAGTGGGTGAGATGCTGGAGAAGAGAGGAGAGGAGAGAGGCAGAGAGCGGTCTCAGGCTGGTGGGAGGGGCGCCCACCTCCCCACGCCCTCCCCTCCCCTGCTGCAGGGGCTCTGGAGAGAAACAATAAAGAGATTCACAC