Transcript asmbl_88901

Sequence
Transcript Sequence for observation asmbl_88901 of TGE0058713:
ACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCTGTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGCGTCACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGACTTGGCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCCTTTGTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTGGCCCTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCTGAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACCTACAATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTCCTCTCTGGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCCCTGGCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCAGTCTGGATCGGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGCAA