Transcript asmbl_88811

Sequence
Transcript Sequence for observation asmbl_88811 of TGE0001245:
GAGGTGTTTAGGAGAAAGTAGGGGCTGTGGGTGTCGGGAGCCGGCTGACGGGTGGACAAGGGGGGGTTAGCAGCTGGGCTGCGACCGTTAGGGAGGGGCTCAAGGTGTGCATGTGTGAGGGAAGAGAGAGAGAGAGAAGGGCGCCTCAGAGGTGACTTTCAGCCTGCGAGCCTTCTTCCCGGGGCGCCATAAACGCCCCCAATTTCCCAGCTGCTAAAGGAAGAGGAAGGTACCTGTGCGTGCACGCAGACGGGAAGGGCTGGGGAAGCGGGAGGACTGAGAAAAGCCGGATCTTAGCAAAGCAATGTCTCAAGATGGTGCTTCTCAGTTCCAAGAAGTCATTCGGCAAGAGCTAGAATTATCTGTGAAGAAGGAACTAGAAAAAATACTCACCACAGCATCATCACATGAATTTGAGCACACCAAAAAAGACCTGGATGGATTTCGGAAGCTATTTCATAGATTTTTGCAAGAAAAGGGGCCTTCTGTGGATTGGGGAAAAATCCAGAGACCCCCTGAAGATTCGATTCAACCCTATGAAAAGATAAAGGCCAGGGGCTTGCCTGATAATATATCTTCCGTGTTGAACAAACTAGTGGTGGTGAAACTCAATGGTGGTTTGGGAACCAGCATGGGCTGCAAAGGCCCTAAAAGTCTGATTGGTGTGAGGAATGAGAATACCTTTCTGGATCTGACTGTTCAGCAAATTGAACATTTGAATAAAACCTACAATACAGATGTTCCTCTTGTTTTAATGAACTCTTTTAACACGGATGAAGATACCAAAAAAATACTACAGAAGTACAATCATTGTCGTGTGAAAATCTACACTTTCAATCAAAGCAGGTACCCGAGGATTAATAAAGAATCTTTACTTCCTGTAGCAAAGGACGTGTCTTACTCAGGGGAAAATACAGAAGCTTGGTACCCTCCAGGTCATGGTGATATTTACGCCAGTTTCTACAACTCTGGATTGCTTGATACCTTTATAGGAGAAGGCAAAGAGTATATTTTTGTGTCTAACATAGATAATCTGGGTGCCACAGTGGATCTGTATATTCTTAATCATCTAATGAACCCACCCAATGGAAAACGCTGTGAATTTGTCATGGAAGTCACAAATAAAACACGTGCAGATGTAAAGGGCGGGACACTCACTCAATATGAAGGCAAACTGAGACTGGTGGAAATTGCTCAAGTGCCAAAAGCACATGTAGACGAGTTCAAGTCTGTATCAAAGTTCAAAATATTTAATACAAACAACCTATGGATTTCTCTTGCAGCAGTTAAAAGACTGCAGGAGCAAAATGCCATTGACATGGAAATCATTGTGAATGCAAAGACTTTGGATGGAGGCCTGAATGTCATTCAATTAGAAACTGCAGTAGGGGCTGCCATCAAAAGTTTTGAGAATTCTCTAGGTATTAATGTGCCAAGGAGCCGTTTTCTGCCTGTCAAAACCACATCAGATCTCTTGCTGGTGATGTCAAACCTCTATAGTCTTAATGCAGGATCTCTGACAATGAGTGAAAAGCGGGAATTTCCTACAGTGCCCTTGGTTAAATTAGGCAGTTCTTTTACGAAGGTTCAAGATTATCTAAGAAGATTTGAAAGTATACCAGATATGCTTGAATTGGATCACCTCACAGTTTCAGGAGATGTGACATTTGGAAAAAATGTTTCATTAAAGGGAACGGTTATCATCATTGCAAATCATGGTGACAGAATTGATATCCCACCTGGAGCAGTATTAGAGAACAAGATTGTGTCTGGAAACCTTCGCATCTTGGACCACTGAAATGAAAAATACTGTGGACACTTAAATAATGGGCTAGTTTCTTACAATGAAATGTTCTCTAGGATTCTAAAATAGGCAGGTACTTTACTATGTTACTGTACCCTGCAGTGTTGATTTTTAAAATAGAGTTTTCTGCAGTATGCTTTTAGTCTAAGAAAAGCACAGATGGAGCAATACTTTCCTTCTTTGAAGAGAATCCCAAAAGTTAGTTCATCTTAAAGTGCAATATTGTTTAATCTTAAAACTGGGCAACTTTGGAAGAACTTTTAACAGAAGCCTCAATGATGATCACTTTGAATTGCTTGTGATTTCAAAAATAAAGCAGTGAAGCAATACTTGTGTACACTGGTACTTTATAATGCTAACTATAAACTGGTTTATTGTTGTTAGACAGTTACTATATTAGTTGGAAGATTTGCC