Transcript asmbl_88809

Sequence
Transcript Sequence for observation asmbl_88809 of TGE0001245:
GAGGTGTTTAGGAGAAAGTAGGGGCTGTGGGTGTCGGGAGCCGGCTGACGGGTGGACAAGGGGGGGTTAGCAGCTGGGCTGCGACCGTTAGGGAGGGGCTCAAGGTGTGCATGTGTGAGGGAAGAGAGAGAGAGAGAAGGGCGCCTCAGAGGTGACTTTCAGCCTGCGAGCCTTCTTCCCGGGGCGCCATAAACGCCCCCAATTTCCCAGCTGCTAAAGGAAGAGGAAGATCTTAGCAAAGCAATGTCTCAAGATGGTGCTTCTCAGTTCCAAGAAGTCATTCGGCAAGAGCTAGAATTATCTGTGAAGAAGGAACTAGAAAAAATACTCACCACAGCATCATCACATGAATTTGAGCACACCAAAAAAGACCTGGATGGATTTCGGAAGCTATTTCATAGATTTTTGCAAGAAAAGGGGCCTTCTGTGGATTGGGGAAAAATCCAGAGACCCCCTGAAGATTCGATTCAACCCTATGAAAAGATAAAGGCCAGGGGCTTGCCTGATAATATATCTTCCGTGTTGAACAAACTAGTGGTGGTGAAACTCAATGGTGGTTTGGGAACCAGCATGGGCTGCAAAGGCCCTAAAAGTCTGATTGGTGTGAGGAATGAGAATACCTTTCTGGATCTGACTGTTCAGCAAATTGAACATTTGAATAAAACCTACAATACAGATGTTCCTCTTGTTTTAATGAACTCTTTTAACACGGATGAAGATACCAAAAAAATACTACAGAAGTACAATCATTGTCGTGTGAAAATCTACACTTTCAATCAAAGCAGGTACCCGAGGATTAATAAAGAATCTTTACTTCCTGTAGCAAAGGACGTGTCTTACTCAGGGGAAAATACAGAAGCTTGGTACCCTCCAGGTCATGGTGATATTTACGCCAGTTTCTACAACTCTGGATTGCTTGATACCTTTATAGGAGAAGGCAAAGAGTATATTTTTGTGTCTAACATAGATAATCTGGGTGCCACAGTGGATCTGTATATTCTTAATCATCTAATGAACCCACCCAATGGAAAACGCTGTGAATTTGTCATGGAAGTCACAAATAAAACACGTGCAGATGTAAAGGGCGGGACACTCACTCAATATGAAGGCAAACTGAGACTGGTGGAAATTGCTCAAGTGCCAAAAGCACATGTAGACGAGTTCAAGTCTGTATCAAAGTTCAAAATATTTAATACAAACAACCTATGGATTTCTCTTGCAGCAGTTAAAAGACTGCAGGAGCAAAATGCCATTGACATGGAAATCATTGTGAATGCAAAGACTTTGGATGGAGGCCTGAATGTCATTCAATTAGAAACTGCAGTAGGGGCTGCCATCAAAAGTTTTGAGAATTCTCTAGGTATTAATGTGCCAAGGAGCCGTTTTCTGCCTGTCAAAACCACATCAGATCTCTTGCTGGTGATGTCAAACCTCTATAGTCTTAATGCAGGATCTCTGACAATGAGTGAAAAGCGGGAATTTCCTACAGTGCCCTTGGTTAAATTAGGCAGTTCTTTTACGAAGGTTCAAGATTATCTAAGAAGATTTGAAAGTATACCAGATATGCTTGAATTGGATCACCTCACAGTTTCAGGAGATGTGACATTTGGAAAAAATGTTTCATTAAAGGGAACGGTTATCATCATTGCAAATCATGGTGACAGAATTGATATCCCACCTGGAGCAGTATTAGAGAACAAGATTGTGTCTGGAAACCTTCGCATCTTGGACCACTGAAATGAAAAATACTGTGGACACTTAAATAATGGGCTAGTTTCTTACAATGAAATGTTCTCTAGGATTCTAAAATAGGCAGGTACTTTACTATGTTACTGTACCCTGCAGTGTTGATTTTTAAAATAGAGTTTTCTGCAGTATGCTTTTAGTCTAAGAAAAGCACAGATGGAGCAATACTTTCCTTCTTTGAAGAGAATCCCAAAAGTTAGTTCATCTTAAAGTGCAATATTGTTTAATCTTAAAACTGGGCAACTTTGGAAGAACTTTTAACAGAAGCCTCAATGATGATCACTTTGAATTGCTTGTGATTTCAAAAATAAAGCAGTGAAGCAATACTTGTGTACACTGGTACTTTATAATGCTAACTATAAACTGGTTTATTGTTGTTAGACAGTTACTATATTAGTTGGAAGATTTGCC