Transcript asmbl_88766

Sequence
Transcript Sequence for observation asmbl_88766 of TGE0001243:
CTTTTAAAAATTCTCTTAGCCACGTTGATTGTACGGGAAAAGCCTTTTTAAAACATCTTTTACGTTGCTTAAACCTACAGTTTCGAAAGCATTCCGAAGGCTAAAGTGAGAAATAAGCCCAGGCTAGGGAGAGGAGAAACGAAGTTCACGTCCTAGTCTGGCACCGGGTTGGATTGTCGCTGGGACGGCAGTCAGGCATTTGGTGTGGTCGCCTAAGGGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCGGATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAATATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTGGCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAGTGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTATTGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACATGAACTAACATTTATTGTTGGGTTTTAT