Transcript asmbl_88765

Sequence
Transcript Sequence for observation asmbl_88765 of TGE0058712:
CTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCGGATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAATATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTGGCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAGTGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTATTGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACATGAACTAACATTTATTGTTGGGTTTTAT