Transcript asmbl_88764

Sequence
Transcript Sequence for observation asmbl_88764 of TGE0001243:
TGCGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCCTGACCTAACCTGTCTCTTCCTTTTCCTCAACCTCAGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCGGATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAATATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTGGCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAGTGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTATTGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACATGAACTAACATTTATTGTTGGGTTTTAT