Transcript asmbl_88756

Sequence
Transcript Sequence for observation asmbl_88756 of TGE0056599:
GCCCAGCCCCCGGAATCAGTGCCGCTGTTGCCGTGCAGGCTGCGGATTCCTCCAGTCCCTCCCTCGGCCGCCTCTCCTCCCGGAGCGAGCGCGCAGCCCTGCGCAGCAGCGCCCACTGGTCCCGTCCTGTGAGCCCCGGCCCCAGCCGCGGACAGACCCGCGGAGTCGCCTCCCGGCCCACCCGCCCGGCCGCCGAGGAGCGGGAGGAGGACGGGACCCCGGCGCCCCCACCCCATCCCCGGGAGAACTCTAAGAAGGAGCTGATGTGGAGGAGCAGCTGAGACAGTTCAAGATGACGACCACAGTAGCCACAGACTATGACAACATTGAGATCCAGCAGCAGTACAGTGATGTCAACAACCGCTGGGATGTCGACGACTGGGACAATGAGAACAGCTCTGCGCGGCTTTTTGAGCGGTCCCGCATCAAGGCTCTGGCAGATGAGCGTGAAGCCGTGCAGAAGAAGACCTTCACCAAGTGGGTCAATTCCCACCTTGCCCGTGTGTCCTGCCGGATCACAGACCTGTACACTGACCTTCGAGATGGACGGATGCTCATCAAGCTGCTGGAGGTCCTCTCTGGAGAGAGGCTGCCTAAACCCACCAAGGGACGAATGCGCATCCACTGCTTAGAGAATGTGGACAAGGCCCTTCAGTTCCTGAAGGAGCAGAGAGTCCATCTTGAGAACATGGGGTCCCATGACATCGTGGATGGAAACCACCGGCTGACCCTTGGCCTCATCTGGACCATCATCCTGCGCTTCCAGATCCAGGATATCAGTGTGGAAACTGAAGACAACAAAGAGAAGAAATCTGCCAAGGATGCATTGCTGTTGTGGTGCCAGATGAAGACAGCTGGGTACCCCAATGTCAACATTCACAATTTCACCACTAGCTGGAGGGACGGCATGGCCTTCAATGCACTGATACACAAACACCGGCCTGACCTGATAGATTTTGACAAACTAAAGAAATCTAACGCACACTACAACCTGCAGAATGCATTTAATCTGGCAGAACAGCACCTCGGCCTCACTAAACTGTTGGACCCCGAAGACATCAGCGTGGACCATCCTGATGAGAAGTCCATAATCACTTATGTGGTGACTTATTACCACTACTTCTCTAAGATGAAGGCCTTAGCTGTTGAAGGAAAACGAATTGGAAAGGTGCTTGACAATGCTATTGAAACAGAAAAAATGATTGAAAAGTATGAATCACTTGCCTCTGACCTTCTGGAATGGATTGAACAAACCATCATCATTCTGAACAATCGCAAATTTGCCAATTCACTGGTCGGGGTTCAACAGCAGCTTCAGGCATTCAACACTTACCGCACTGTGGAGAAACCACCCAAATTTACTGAGAAGGGGAACTTGGAAGTGCTGCTCTTCACCATTCAGAGCAAGATGAGGGCCAACAACCAGAAGGTCTACATGCCCCGGGAGGGGAAGCTCATCTCTGACATCAACAAGGCCTGGGAAAGACTGGAAAAAGCGGAACACGAAAGAGAACTGGCTTTGCGGAATGAGCTCATAAGACAGGAGAAACTGGAACAGCTCGCCCGCAGATTTGATCGCAAGGCAGCTATGAGGGAGACTTGGCTGAGCGAAAACCAGCGTCTGGTGTCTCAGGACAACTTTGGGTTTGACCTTCCTGCAGTTGAGGCCGCCACAAAAAAGCACGAGGCCATTGAGACAGACATTGCCGCATACGAGGAGCGTGTGCAGGCTGTGGTAGCCGTGGCCAGGGAGCTCGAGGCCGAGAATTACCACGACATCAAGCGCATCACAGCGAGGAAGGACAATGTCATCCGGCTCTGGGAATACCTACTGGAACTGCTCAGGGCCCGGAGACAGCGGCTCGAGATGAACCTGGGGCTGCAGAAGATATTCCAGGAAATGCTCTACATTATGGACTGGATGGATGAAATGAAGGTGCTAGTATTGTCTCAAGACTATGGCAAACACTTACTTGGTGTGGAAGACCTGTTACAGAAGCACACCCTGGTTGAAGCAGACATTGGCATCCAGGCAGAGCGGGTGAGAGGTGTCAATGCCTCCGCCCAGAAGTTCGCAACAGACGGGGAAGGTTACAAGCCCTGTGACCCCCAGGTGATCCGAGACCGCGTGGCCCACATGGAGTTCTGTTATCAAGAGCTTTGCCAGCTGGCGGCTGAGCGCAGGGCCCGTCTGGAAGAGTCCCGCCGCCTCTGGAAGTTCTTCTGGGAGATGGCAGAAGAGGAAGGCTGGATACGGGAGAAGGAGAAGATCCTGTCCTCGGACGATTACGGGAAAGACCTGACCAGCGTCATGCGCCTGCTCAGCAAGCACCGGGCGTTCGAGGACGAGATGAGCGGCCGCAGTGGCCACTTTGAGCAGGCCATCAAGGAAGGCGAAGACATGATCGCGGAGGAGCACTTCGGGTCGGAGAAGATCCGTGAGAGGATCATTTACATCCGGGAGCAGTGGGCCAACCTAGAGCAGCTCTCGGCCATTCGGAAGAAGCGCCTGGAGGAGGCCTCCCTGCTGCACCAGTTCCAGGCAGATGCTGATGACATTGATGCCTGGATGCTGGACATCCTCAAGATTGTCTCCAGCAGCGACGTGGGCCACGATGAGTATTCCACACAGTCTCTGGTCAAGAAACACAAGGACGTGGCGGAAGAGATCGCCAATTACAGGCCCACCCTTGACACGCTGCACGAACAAGCCAGCGCCCTCCCCCAGGAGCATGCCGAGTCTCCAGACGTGAGGGGCAGGCTGTCGGGCATCGAGGAGCGGTATAAGGAGGTGGCAGAGCTGACGCGGCTGCGGAAGCAGGCACTCCAGGACACTCTGGCCCTGTACAAGATGTTCAGCGAGGCTGATGCCTGTGAGCTCTGGATCGACGAGAAGGAGCAGTGGCTCAACAACATGCAGATCCCAGAGAAGCTGGAGGATCTGGAGGTCATCCAGCACAGATTTGAGAGCCTAGAACCAGAAATGAACAACCAGGCTTCCCGGGTTGCAGTGGTGAACCAGATTGCACGCCAGCTGATGCACAGCGGCCACCCAAGTGAGAAGGAAATCAAAGCCCAGCAGGACAAACTCAACACAAGGTGGAGCCAGTTCAGAGAACTGGTTGACAGGAAGAAGGATGCCCTCCTGTCTGCCCTGAGCATCCAGAACTACCACCTCGAGTGCAATGAAACCAAATCCTGGATTCGGGAAAAGACCAAGGTCATCGAGTCCACCCAGGACCTGGGCAATGACCTGGCTGGCGTCATGGCCCTGCAGCGCAAGCTGACCGGCATGGAGCGGGACTTGGTGGCCATTGAGGCAAAGCTGAGTGACCTGCAGAAGGAGGCGGAGAAGCTGGA