Transcript asmbl_88539

Sequence
Transcript Sequence for observation asmbl_88539 of TGE0056598:
AGGAGGCCAGGGCCCGCCCCACAGCCACTCTCGCGCCTCCGAACAGCCACAGGGGCAAAGCCCTGTCACCCCCAGGATCCGGTCATCAGGGAAAGAGGACAGGGAGACCAGAAGAGGGCCAGCTGGGACGAGGGGGCGGACGCCCAGGAGGCAACTTCTGAGACGCAGCTCCTGAGAGGGGCAGGGACCAGGCGCGGGAGGCCAGAGGGGGCACAGAGAACAAACCCCCTCAGAAGTGAAGAGGAGAGCGGAAGGAACCGAGAGGGGACGGACAGGAGCTGAGGAGGAAAGAGGAGGGGAGAGGGGTCAGGCCAGGCAGCCAAGGAGAAGACGTGTGGCCGGGGGCTATCAGAAGGAAACTGGGACGGACGGGCCGGGCTCGGGCTGTCCTGTGGAGCAGCAGCATCCCCGGGGCCGGCAGAGGCGCCAGTGGCTGGGCGGGATGAGTCTCTGAGGGCCACTGTGGAGCGCCCCGCCATGGCCCCCCGCACCCTCTGGAGCTGCTACCTCTGCTGCCTGCTGACGGCAGCTGCAGGGGCCGCCAGCTACCCTCCTCGAGGTTTCAGCCTCTACACAGGTTCCAGTGGGGCCCTCAGCCCCGGGGGGCCCCAGGCCCAGATTGCCCCCCGGCCAGCCAGCCGCCACAGGAACTGGTGTGCCTACGTGGTGACCCGGACAGTGAGCTGTGTCCTTGAGGATGGAGTGGAGACATATGTCAAGTACCAGCCTTGTGCCTGGGGCCAGCCCCAGTGTCCCCAAAGCATCATGTACCGCCGCTTCCTCCGCCCTCGCTACCGTGTGGCCTACAAGACAGTGACCGACATGGAGTGGAGGTGCTGTCAGGGTTATGGGGGCGATGACTGTGCTGAGAGTCCCGCTCCAGCGCTGGGGCCTGCGTCTTCCACACCACGGCCCCTGGCCCGGCCTGCCCGCCCCAACCTCTCTGGCTCCAGTGCAGGCAGCCCCCTCAGTGGACTGGGGGGAGAAGGTCCTGGGGAGTCAGAGAAGGTGCAGCAGCTGGAGGAACAGGTGCAGAGCCTGACCAAGGAGCTGCAAGGCCTGCGGGGCGTCCTGCAAGGACTGAGCGGGCGCCTGGCAGAGGATGTGCAGAGGGCTGTGGAGACGGCCTTCAACGGGAGGCAGCAGCCAGCTGACGCGGCTGCCCGCCCTGGGGTGCATGAAACCCTCAATGAGATCCAGCACCAGCTGCAGCTCCTGGACACCCGCGTCTCCACCCACGACCAGGAGCTGGGTCACCTCAACAACCATCATGGCGGCAGCAGCAGCAGTGGGGGCAGCAGGGCCCCAGCCCCAGCCTCAGCCCCTCCGGGCCCCAGTGAGGAGCTGCTGCGGCAGCTGGAGCAGCGGTTGCAGGAGTCCTGCTCCGTGTGCCTGGCCGGGCTAGATGGCTTCCGCCGGCAGCAGCAGGAGGACAGGGAGCGGCTGCGAGCGATGGAGAAGCTGCTGGCCTCGGTGGAGGAGCGGCAACGGCACCTCGCAGGGCTGGCGGTGGGCCGCAGGCCCCCTCAGGAATGCTGCTCTCCAGAGCTGGGCCGGCGACTGGCAGAGCTGGAGCGCAGGCTGGATGTCGTGGCCGGCTCAGTGACAGTGCTGAGTGGGCGGCGAGGCACAGAGCTGGGAGGAGCCGCGGGGCAGGGAGGCCACCCCCCAGGCTACACCAGCTTGGCCTCCCGCCTGTCTCGCCTGGAGGACCGCTTCAACTCCACCCTGGGCCCTTCGGAGGAGCAGGAGGAGAGCTGGCCTGGGGCTCCTGGGGGGCTGAGCCACTGGCTGCCTGCTGCCCGGGGCCGACTAGAGCAGTTGGGGGGGCTGCTGGCCAATGTGAGCGGGGAGCTGGGGGGGCGGTTGGATCTGTTGGAGGAGCAGGTGGCAGGGGCCATGCAGGCATGCGGGCAGCTCTGCTCTGGGGCCCCTGGGGAGCAGGACTCTCAAGTCAGCGAGATCCTCAGTGCCTTGGAGCGCAGGGTGCTGGACAGTGAGGGGCAGCTGCGGCTGGTGGGCTCCGGCCTGCACACGGTGGAAGCAGCGGGGGAGGCCCGGCAGGCCACGCTGGAGGGATTACAAGAGGTTGTGGGCCGGCTCCAGGATCGTGTGGATGCCCAGGATGAGACAGCTGCAGAGTTCACACTACGGCTGAATCTCACTGCGGCCCGGCTAGGCCAACTGGAGGGGCTGCTGCAGGCCCATGGGGATGAGGGCTGTGGGGCCTGTGGCGGAGTCCAAGAGGAACTAGGCCGCCTTCGGGATGGTGTGGAGCGCTGCTCCTGCCCCCTGTTGCCTCCTCGGGGTCCTGGGGCTGGTCCAGGTGTTGGGGGCCCAAGCCGTGGGCCCCTGGACGGCTTCAGCGTGTTTGGGGGCAGCTCAGGCTCAGCCCTGCAGGCCCTGCAAGGAGAGCTCTCTGAGGTTATTCTCAGCTTCAGCTCCCTCAATGACTCACTGAATGAGCTCCAGACCACTGTGGAGGGCCAGGGCGCTGATCTGGCTGACCTGGGGGCAACCAAGGACCGTATCATTTCTGAGATTAACAGGCTGCAGCAGGAGGCCACAGAGCATGCTACAGAGAGTGAAGAGCGCTTCCGAGGCCTAGAGGAGGGACAAGCACAGGCCGGCCAGTGCCCCAGCTTAGAGGGGCGATTGGGCCGTCTTGAGGGTGTCTGTGAACGGTTGGACACTGTGGCTGGGGGACTGCAGGGCCTGCGCGAGGGCCTTTCCAGACACGTGGCTGGGCTCTGGGCTGGGCTCCGGGAAACCAACACCACCAGCCAGATGCAGGCAGCCCTGCTGGAGAAGCTGGTCGGGGGACAGGCGGGCCTGGGCAGGCGGCTGGGTGCCCTTAACAGCTCCCTGCAGCTCCTGGAGGACCGTCTGCACCAGCTCAGCCTGAAGGACCTCACTGGGCCTGCAGGAGAGGCTGGGCCCCCAGGGCCTCCTGGGCTGCAGGGACCCCCAGGCCCTGCTGGACCTCCAGGATCACCAGGCAAGGACGGGCAAGAGGGCCCCATCGGGCCACCAGGTCCTCAAGGTGAACAGGGAGTGGAGGGGGCACCAGCAGCCCCTGTGCCCCAAGTGGCATTTTCAGCTGCTCTGAGTTTGCCCCGGTCTGAACCAGGCACGGTCCCCTTCGACAGAGTCCTGCTCAATGATGGAGGCTATTATGATCCAGAGACAGGCGTGTTCACAGCGCCACTGGCTGGACGCTACTTGCTGAGCGCGGTGCTGACTGGGCACCGGCACGAGAAAGTGGAGGCCGTGCTGTCCCGCTCCAACCAGGGCGTGGCCCGCGTAGACTCCGGTGGCTACGAGCCTGAGGGCCTGGAGAATAAGCCGGTGGCCGAGAGCCAGCCCAGCCCGGGCACCCTGGGCGTCTTCAGCCTCATCCTGCCGCTGCAGGCCGGGGACACGGTCTGCGTCGACCTGGTCATGGGGCAGCTGGCGCACTCGGAGGAGCCGCTCACCATCTTCAGCGGGGCCCTGCTCTATGGGGACCCAGAGCTTGAACACGCGTAGACTGGGGTCCCGCCCGACGTGTCTACGTCGGCTGAAGAGACAGCGGGGGCGGCGGGCTCCTGGGGTCTCGCCTGAGACGGGGCACCTAGCCCTGGGCGAGCGCCGCACCCGGGCCCGCAGCGGCACCGCGCCCAGAGCGGCCTCTCCCCACGCCCGGGGCGCGCCGGCTCAGGGAGGCTCGGGGCCGCCCATGCAGACTTTTGGCCTGGCGCGATCCCCCAAGAACCCCTCCAGGGCCGGCCTGCGGAGGAGCCGATCCTCGCACCCTCCGCTCCCTCCACTGGCCCTCCAGGTCGATTCCCTGGGCTCCAGGCTCCCCCGCGCGGGCGCCGCCCACCGCCATACTAAACGATCGAGGAATAAAGACACTTGG