Transcript asmbl_88522

Sequence
Transcript Sequence for observation asmbl_88522 of TGE0058711:
CGCCCCTTGGTCCCGCAGAGCCTTGGTACTTGGACCTGAACCTTGCTCCGAGAGGGAGTCCTCGCGGACGTCAGCCAAGATTCCAGAATGACTATCTTGACTTACCCCTTTAAAAATCTTCCCACTGCATCAAAATGGGCCCTCAGATTTTTTTATTTTGTCTTCCAGCCATAAGACCTCTGAGCTGTTCCTCCCAGCTACGAGCTGCCCCAGCTGTCCAGACCAAAACGAAGAAGACGTTAGCCAAACCCAATATAAGGAATGTTGTGGTGGTGGATGGTGTTCGCACTCCATTTTTGCTGTCTGGCACTTCATATAAAGACCTGATGCCACATGATTTGGCTAGAGCAGCGCTTACGGGTTTGTTGCATCGGACCAGTGTCCCTAAGGAAGTAGTTGATTATATCATCTTTGGTACAGTTATTCAGGAAGTGAAAACAAGCAATGTGGCTAGAGAGGCTGCCCTTGGAGCTGGCTTCTCTGACAAGACTCCTGCTCACACTGTCACCATGGCTTGTATCTCTGCCAACCAAGCCATGACCACAGGTGTTGGCTTGATTGCTTCTGGCCAGTGTGATGTGATCGTGGCAGGTGGTGTTGAGTTGATGTCCGATGTCCCTATTCGTCACTCAAGGAAAATGAGAAAACTGATGCTTGATCTCAATAAGGCCAAATCTATGGGCCAGCGACTGTCTTTAATCTCTAAATTCCGATTTAATTTCCTAGCACCTGAGCTCCCTGCGGTTTCTGAGTTCTCCACCAGTGAGACCATGGGCCACTCTGCAGACCGACTGGCCGCTGCCTTTGCTGTTTCTCGGCTGGAACAGGATGAATATGCACTGCGCTCTCACAGTCTAGCCAAGAAGGCACAGGATGAAGGACTCCTTTCTGATGTGGTACCCTTCAAAGTACCAGGAAAAGATACAGTTACCAAAGATAATGGCATCCGTCCTTCCTCACTGGAGCAGATGGCCAAACTAAAACCTGCATTCATCAAGCCCTACGGCACAGTGACAGCTGCAAATTCTTCTTTCTTGACTGATGGTGCATCTGCAATGTTAATCATGGCGGAGGAAAAGGCTCTGGCCATGGGTTATAAGCCGAAGGCATATTTGAGGGATTTTATGTATGTGTCTCAGGATCCAAAAGATCAACTATTACTTGGACCAACATATGCTACTCCAAAAGTTCTAGAAAAGGCAGGATTGACCATGAATGATATTGATGCTTTTGAATTTCATGAAGCTTTCTCGGGTCAGATTTTGGCAAATTTTAAAGCCATGGATTCTGATTGGTTTGCAGAAAACTACATGGGTAGAAAAACCAAGGTTGGATTGCCTCCTTTGGAGAAGTTTAATAACTGGGGTGGATCTCTGTCCCTGGGACACCCATTTGGAGCCACTGGCTGCAGGTTGGTCATGGCTGCTGCCAACAGATTACGGAAAGAAGGAGGCCAGTATGGCTTAGTGGCTGCGTGTGCAGCTGGAGGGCAGGGCCATGCTATGATAGTGGAAGCTTATCCAAAATAATAGATCCAGAAGAAGTGACCTGAAGTTTCTGTGCAACACTCACACTAGGCAATGCCATTTCAATGCATTACTAAATGACATTTGTAGTTCCTAGCTCCTCTTAGGAAAACAGTTCTTGTGGCCTTCTATTAAATAGTTTGCACTTAAGCCTTGCCAGTGTTCTGAGCTTTTCAATAATCAGTTTACTGCTCTTTCAGGGATTTCTAAGCCACCAGAATCTCACATGAGATGTGTGGGTGGTTGTTTTTGGTCTCTGTTGTCACTAAAGACTAAATGAGGGTTTGCAGTTGGGAAAGAGGTCAACTGAGATTTGGAAATCATCTTTGTAATATTTGCAAATTATACTTGTTCTTATCTGTGTCCTAAAGATGTGTTCTCTATAAAATACAAACCAACGTGCCTAATTAATTATGGAAAAATAATTCAGAATCTAAACACCACTGAAAACTTATAAAAAATGTTTAGATACATAAATATGGTGGTCAGCGTTAATAAAGTGGAGAAATATTGGAGAA