Transcript asmbl_88521

Sequence
Transcript Sequence for observation asmbl_88521 of TGE0001226:
CGCCCCTTGGTCCCGCAGAGCCTTGGTACTTGGACCTGAACCTTGCTCCGAGAGGGAGTCCTCGCGGACGTCAGCCAAGATTCCAGAATGACTATCTTGACTTACCCCTTTAAAAATCTTCCCACTGCATCAAAATGGGCCCTCAGATTTTCCATAAGACCTCTGAGCTGTTCCTCCCAGCTACGAGCTGCCCCAGCTGTCCAGACCAAAACGAAGAAGACGTTAGCCAAACCCAATATAAGGAATGTTGTGGTGGTGGATGGTGTTCGCACTCCATTTTTGCTGTCTGGCACTTCATATAAAGACCTGATGCCACATGATTTGGCTAGAGCAGCGCTTACGGGTTTGTTGCATCGGACCAGTGTCCCTAAGGAAGTAGTTGATTATATCATCTTTGGTACAGTTATTCAGGAAGTGAAAACAAGCAATGTGGCTAGAGAGGCTGCCCTTGGAGCTGGCTTCTCTGACAAGACTCCTGCTCACACTGTCACCATGGCTTGTATCTCTGCCAACCAAGCCATGACCACAGGTGTTGGCTTGATTGCTTCTGGCCAGTGTGATGTGATCGTGGCAGGTGGTGTTGAGTTGATGTCCGATGTCCCTATTCGTCACTCAAGGAAAATGAGAAAACTGATGCTTGATCTCAATAAGGCCAAATCTATGGGCCAGCGACTGTCTTTAATCTCTAAATTCCGATTTAATTTCCTAGCACCTGAGCTCCCTGCGGTTTCTGAGTTCTCCACCAGTGAGACCATGGGCCACTCTGCAGACCGACTGGCCGCTGCCTTTGCTGTTTCTCGGCTGGAACAGGATGAATATGCACTGCGCTCTCACAGTCTAGCCAAGAAGGCACAGGATGAAGGACTCCTTTCTGATGTGGTACCCTTCAAAGTACCAGGAAAAGATACAGTTACCAAAGATAATGGCATCCGTCCTTCCTCACTGGAGCAGATGGCCAAACTAAAACCTGCATTCATCAAGCCCTACGGCACAGTGACAGCTGCAAATTCTTCTTTCTTGACTGATGGTGCATCTGCAATGTTAATCATGGCGGAGGAAAAGGCTCTGGCCATGGGTTATAAGCCGAAGGCATATTTGAGGGATTTTATGTATGTGTCTCAGGATCCAAAAGATCAACTATTACTTGGACCAACATATGCTACTCCAAAAGTTCTAGAAAAGGCAGGATTGACCATGAATGATATTGATGCTTTTGAATTTCATGAAGCTTTCTCGGGTCAGATTTTGGCAAATTTTAAAGCCATGGATTCTGATTGGTTTGCAGAAAACTACATGGGTAGAAAAACCAAGGTTGGATTGCCTCCTTTGGAGAAGTTTAATAACTGGGGTGGATCTCTGTCCCTGGGACACCCATTTGGAGCCACTGGCTGCAGGTTGGTCATGGCTGCTGCCAACAGATTACGGAAAGAAGGAGGCCAGTATGGCTTAGTGGCTGCGTGTGCAGCTGGAGGGCAGGGCCATGCTATGATAGTGGAAGCTTATCCAAAATAATAGATCCAGAAGAAGTGACCTGAAGTTTCTGTGCAACACTCACACTAGGCAATGCCATTTCAATGCATTACTAAATGACATTTGTAGTTCCTAGCTCCTCTTAGGAAAACAGTTCTTGTGGCCTTCTATTAAATAGTTTGCACTTAAGCCTTGCCAGTGTTCTGAGCTTTTCAATAATCAGTTTACTGCTCTTTCAGGGATTTCTAAGCCACCAGAATCTCACATGAGATGTGTGGGTGGTTGTTTTTGGTCTCTGTTGTCACTAAAGACTAAATGAGGGTTTGCAGTTGGGAAAGAGGTCAACTGAGATTTGGAAATCATCTTTGTAATATTTGCAAATTATACTTGTTCTTATCTGTGTCCTAAAGATGTGTTCTCTATAAAATACAAACCAACGTGCCTAATTAATTATGGAAAAATAATTCAGAATCTAAACACCACTGAAAACTTATAAAAAATGTTTAGATACATAAATATGGTGGTCAGCGTTAATAAAGTGGAGAAATATTGGAGAA