Transcript asmbl_82688

Sequence
Transcript Sequence for observation asmbl_82688 of TGE0058710:
GCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTACTGGTGTCCACACCGGTCTGAATGCTTCCTCTGGCCACATTCACTGCCCCTGTGAGCCCAGTGGACACAGCATCTTTGGTGCCGGTCAGCACAGCCTT