Transcript asmbl_81948

Sequence
Transcript Sequence for observation asmbl_81948 of TGE0056597:
TCCACATCTTCTACCAGCTGCTGGGGGGCGCTGGAGAGCAGCTCAAAGCCGACCTCCTCCTCGAGCCCTGCTCCCACTACCGGTTCCTGACCAACGGGCCGTCATCCTCTCCCGGCCAGGAGCGGGAACTCTTCCAGGAGACGCTGGAGTCGCTGCGGGTCCTGGGATTCAGCCACGAGGAAATCATCTCCATGCTGCGGATGGTCTCAGCAGTTCTCCAGTTTGGCAACATTGCCTTGAAGAGAGAACGGAACACCGATCAAGCCACCATGCCTGACAACACAGCTGCACAGAAGCTCTGCCGCCTCTTGGGACTGGGGGTGACGGATTTCTCCCGAGCCTTGCTCACCCCTCGCATCAAAGTTGGCCGAGACTATGTGCAGAAAGCCCAGACTAAGGAACAGGCTGACTTCGCGCTGGAGGCCCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTTCTGCGCCTCAACCGGGCCTTGGACCGCAGCCCCCGCCAAGGCGCCTCCTTCCTGGGCATCCTGGACATCGCGGGCTTTGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTCTGCATCAACTACACCAACGAGAAGCTGCAGCAGCTCTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGTGAGGGCATCCCCTGGACCTTCCTCGACTTTGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGGCCGGCCAACCCCCCTGGACTCCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACAGACAAGTCGTTTGTGGAGAAGGTAGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGGCCGAGGCACCTGCGGGATCAGGCCGACTTCAGTGTTCTCCACTACGCGGGCAAGGTCGACTACAAGGCCAACGAGTGGCTGATGAAAAACATGGACCCTCTGAATGACAACGTCGCAGCCTTGCTCCACCAGAGCACAGACCGGCTGACGGCAGAGATCTGGAAAGACGTGGAGGGCATCGTGGGGCTGGAACAGGTGAGCAGCCTGGGCGACGGCCCACCAGGTGGCCGCCCCCGTCGGGGTATGTTCCGGACAGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTCATGGCCACACTCAGCAACACCAACCCCAGTTTTGTCCGCTGCATTGTCCCCAACCACGAGAAGAGGGCCGGGAAGCTGGAGCCACGGCTGGTGCTGGACCAGCTTCGCTGCAACGGGGTCCTGGAGGGCATCCGCATCTGTCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGATACGAGATCCTGACACCCAATGCCATCCCCAAGGGCTTCATGGATGGGAAGCAGGCCTGTGAAAAGATGATCCAGGCGCTGGAACTGGACCCCAACCTCTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCTGGGGTCCTGGCCCAGCTGGAAGAGGAGCGAGACCTGAAGGTCACCGACATCATCGTCTCCTTCCAGGCAGCTGCCCGGGGATACCTGGCTCGCAGGGCCTTCCAGAAGCGCCAGCAGCAGCAGAGCGCCCTGAGGGTGATGCAGCGGAACTGCGCGGCCTACCTCAAGCTGAGACACTGGCAGTGGTGGCGGCTGTTTACCAAGGTGAAGCCACTGCTGCAGGTGACGCGGCAGGATGAGGTGCTGCAGGCACGGGCCCAGGAGCTGCAGAAAGTGCAGGAGCTACAGCAGCAGAGCGCCCGCGAAGTTGGGGAGCTCCAGGGCCGAGTGGCACAGCTGGAAGAGGAGCGCGCCCGCCTGGCAGAGCAATTGCGAGCAGAGGCAGAACTGTGTGCAGAGGCCGAGGAGACGCGGGGGAGGCTGGCAGCCCGCAAGCAGGAGCTGGAGCTGGTGGTGTCAGAGCTGGAGGCTCGCGTGGGCGAGGAGGAGGAGTGCAGCCGTCAAATGCAAACCGAGAAGAAGAGGCTGCAGCAGCACATACAGGAGCTAGAGGCCCACCTTGAGGCTGAGGAGGGTGCGCGGCAGAAGCTGCAGCTGGAGAAGGTGACGACAGAGGCAAAAATGAAGAAATTTGAAGAGGACCTGCTGCTCCTGGAAGACCAGAATTCCAAGCTGAGCAAGGAGCGGAAGCTGCTGGAAGATCGTCTGGCCGAGTTCTCATCCCAGGCAGCTGAGGAGGAGGAGAAGGTCAAGAGCCTCAATAAGCTACGGCTCAAATATGAGGCCACAATCGCAGACATGGAGGACCGCCTACGGAAGGAGGAGAAGGGTCGCCAGGAGCTGGAGAAGCTGAAGCGGAGGCTGGATGGGGAGAGCTCAGAGCTGCAGGAGCAGATGGTGGAGCAGCAACAGCGGGCAGAGGAGCTGCGGGCCCAGCTGGGCCGGAAGGAGGAGGAGCTGCAGGCTGCCCTGGCCAGGGCAGAAGACGAGGGTGGGGCCCGGGCCCAGCTGCTGAAATCCCTGCGGGAGGCTCAAGCAGCCCTGGCCGAGGCCCAGGAGGACCTGGAGTCTGAGCGTGTGGCCAGGACCAAGGCGGAGAAGCAGCGCCGGGACCTGGGCGAGGAGCTGGAGGCGCTGCGGGGCGAGCTGGAGGACACGCTGGACTCCACCAACGCACAGCAGGAGCTCCGGTCCAAGAGGGAACAGGAGGTGACGGAGCTGAAGAAGACTCTGGAGGAGGAGACTCGCATCCACGAGGCGGCAGTGCAGGAGCTGAGGCAGCGCCACGGCCAGGCCCTGGGGGAGCTGGCGGAGCAGCTGGAGCAGGCCCGGAGGGGCAAAGGTGCATGGGAGAAGACCCGGCTGGCCCTGGAGGCCGAGGTGTCCGAGCTGCGGGCAGAACTGAGCAGCCTGCAGACTGCACGTCAGGAGGGTGAGCAGCGGAGGCGCCGCCTGGAGTTACAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGATGGGGAGAGGGCACGAGCGGAGGCTGCTGAGAAGCTGCAGCGAGCCCAGGCTGAACTGGAGAATGTGTCTGGGGCGCTGAACGAGGCTGAGTCCAAAACCATCCGTCTTAGCAAGGAGCTGAGCAGCACAGAAGCCCAGCTGCACGATGCCCAGGAGCTGCTGCAGGAGGAGACCAGGGCGAAATTGGCCTTGGGGTCCCGGGTGCGAGCCATGGAGGCTGAGGCAGCCGGGCTGCGTGAGCAGCTGGAGGAGGAGGCAGCTGCCAGGGAACGGGCGGGCCGTGAACTGCAGACTGCCCAGGCCCAGCTTTCCGAGTGGCGGCGGCGCCAGGAGGAGGAGGCAGGGGCACTGGAGGCAGGGGAGGAGGCACGGCGCCGGGCAGCCCGGGAGGCCGAGGCCCTGACCCAGCGCCTGGCAGAAAAGACAGAGACCGTGGATCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACCATGGACCTGGAGCAGCAGCGGCAGCTTGTGAGCACCCTGGAGAAGAAGCAGCGCAAGTTTGACCAGCTTCTGGCAGAGGAGAAGGCAGCTGTACTTCGGGCAGTGGAGGAACGTGAGCGGGCCGAGGCAGAGGGCCGGGAGCGTGAGGCTCGGGCCCTGTCACTGACACGGGCACTGGAGGAGGAGCAGGAGGCACGTGAGGAGCTGGAGCGGCAGAACCGGGCCCTGCGGGCTGAGCTGGAGGCACTGCTGAGCAGCAAGGATGACGTCGGCAAGAGCGTGCATGAGCTGGAACGAGCCTGCCGGGTAGCAGAACAGGCAGCCAATGATCTGCGAGCACAGGTGACAGAACTGGAGGATGAGCTGACAGCGGCCGAGGATGCCAAGCTGCGTCTGGAGGTGACTGTGCAGGCTCTCAAGACTCAGCATGAGCGTGACCTGCAGGGCCGTGATGAGGCTGGTGAAGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGAGATGCAGAGGTGGAGCGGGATGAGGAGCGGAAGCAGCGCACTCTGGCCGTGGCTGCCCGCAAGAAGCTGGAGGGAGAGCTGGAGGAGCTGAAGGCTCAGATGGCCTCTGCCGGCCAGGGCAAGGAGGAGGCGGTGAAGCAGCTTCGCAAGATGCAGGCCCAGATGAAGGAGCTATGGCGGGAGGTGGAGGAGACACGCACCTCCCGGGAGGAGATCTTCTCCCAGAATCGGGAAAGTGAAAAGCGCCTCAAGGGCCTGGAGGCTGAGGTGCTGCGGCTGCAGGAGGAACTGGCCGCCTCGGACCGTGCTCGGCGGCAGGCCCAGCAGGACCGGGATGAGATGGCAGATGAGGTGGCCAATGGTAACCTTAGCAAGGCAGCCATTCTGGAGGAGAAGCGTCAGCTGGAGGGGCGCCTGGGGCAGTTGGAGGAAGAGCTGGAGGAGGAGCAGAGCAACTCGGAGCTGCTCAATGACCGCTACCGCAAGCTGCTCCTGCAGGTAGAGTCACTGACCACAGAGCTGTCAGCTGAGCGCAGTTTCTCAGCCAAGGCAGAGAGCGGGCGGCAGCAGCTGGAACGGCAGATCCAGGAGCTACGGGGACGCCTGGGTGAGGAGGATGCTGGGGCCCGTGCCCGCCACAAGATGACCATTGCTGCCCTTGAGTCTAAGTTGGCCCAGGCTGAGGAGCAGCTAGAGCAAGAGACCAGAGAGCGCATCCTCTCTGGAAAGCTGGTGCGCAGAGCTGAGAAGCGGCTTAAAGAGGTGGTGCTCCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAGGGAAACCTTCGAGTCAAGCAGCTGAAGCGGCAGCTGGAGGAGGCCGAGGAGGAGGCATCCCGGGCTCAGGCCGGCCGCCGGAGGCTGCAGCGTGAGCTGGAAGATGTCACAGAGTCGGCCGAGTCCATGAACCGTGAAGTGACCACACTGAGGAACCGGCTTCGACGCGGCCCCCTCACCTTCACCACCCGCACGGTGCGCCAGGTCTTCCGACTAGAGGAGGGCGTGGCATCCGACGAGGAGGCAGAGGAAGCACAGCCTGGGTCTGGGCCATCCCCGGAGCCTGAGGGGTCCCCACCAGCCCACCCCCAGTGACCCTACCCTGTCCCCAGATGCACTAACAGATGGGGCCCAGCCCCCTTCCTCCCTGGACCCCACGGGCCCCTGTCCCAGGAACCCCGCCCTCTGACTTCTTGCCCTTTGGAAATGGTGCAGCACTCTGGCATTTATCACCCCCACCTGGGTCCCCTGCAACCTCCCATCAAAGGATGACCCCTAAACACAGAGGAGCGGGGCAGGCAGGGAGGCAATGACTGGAGCTACCTTGCTTGTTGGGGGACTGGGTACAGTTGGCAAGCTGTGTTTCCATCAGCTCCCTGTCCTCCTTTCTTCCCTCGTTATTGATCTATAGACATTAGGAAGGGAGTGAGACGGCTCCTCCACCATCCTCAGCCAGTGCAACCCATTCCCTCTGCTTCTCTCTCTCTCTCTCTCTCTC