Transcript asmbl_81821

Sequence
Transcript Sequence for observation asmbl_81821 of TGE0058709:
CCGGACGGGACCGCGAGCACAGGCCGCTCCGCGGGCGCTTCGGATCCTCGCGGGACCCCACCCTCTCCCAGCCTGCCCAGCCCGCTGCAGCCGCCAGCGCGCCCCGTCGGCAGCTCTCCATCTGCACGTCTCTCCGTGAACCCCGTGAGCGGTGTGCAGCCACCATGTTCAGCTGGCTGAAGCGGGGCGGGGCACGGGGCCAGCAGCCCGAGGCCATCCGCACGGTGACCTCGGCCCTCAAGGAGCTGTACCGCACGAAGCTGCTGCCGCTGGAGGAGCACTACCGCTTTGGGGCCTTCCACTCGCCGGCCCTGGAGGACGCAGACTTCGACGGCAAGCCCATGGTGCTGGTGGCCGGCCAGTACAGCACGGGCAAGACCAGCTTCATCCAGTACCTGCTGGAGCAGGAGGTGCCCGGCTCCCGCGTGGGGCCTGAGCCCACCACCGACTGCTTTGTGGCCGTCATGCACGGGGACACTGAGGGCACCGTGCCCGGCAACGCCCTCGTCGTGGACCCGGACAAGCCCTTCCGCAAACTCAACCCTTTCGGAAACACCTTCCTCAACAGGTTCATGTGTGCCCAGCTCCCTAATCAGGTCCTGGAGAGCATCAGCATCATCGACACCCCGGGTATCCTGTCGGGTGCCAAGCAGAGAGTGAGCCGCGGCTACGACTTCCCGGCCGTGCTGCGCTGGTTCGCGGAGCGCGTGGACCTCATCATCCTGCTCTTTGATGCGCACAAGCTGGAGATCTCGGACGAGTTCTCAGAGGCCATCGGCGCGTTGCGGGGCCATGAGGACAAGATCCGCGTGGTGCTCAACAAGGCCGACATGGTGGAGACGCAGCAGCTGATGCGCGTCTACGGCGCGCTCATGTGGGCGCTGGGCAAGGTGGTGGGCACGCCCGAGGTGCTGCGCGTCTACATCGGCTCCTTCTGGTCCCAGCCCCTCCTCGTGCCCGACAACCGGCGCCTCTTCGAGCTGGAGGAGCAGGACCTCTTCCGCGACATCCAGGGCCTGCCCCGGCACGCAGCCTTGCGCAAGCTCAACGACCTGGTGAAGAGGGCCCGGCTGGTGCGAGTTCACGCTTACATCATCAGCTACCTGAAGAAGGAGATGCCCTCTGTGTTTGGGAAGGAGAACAAGAAGAAGCAGCTGATCCTCAAACTGCCCGTCATCTTTGCGAAGATTCAGCTGGAACATCACATCTCCCCTGGGGACTTTCCTGATTGCCAGAAAATGCAGGAGCTGCTGATGGCGCACGACTTCACCAAGTTTCACTCGCTGAAGCCGAAGCTGCTAGAGGCACTGGACGAGATGCTGACGCACGACATCGCCAAGCTCATGCCCCTGCTGCGGCAGGAGGAGCTGGAGAGCACCGAGGTGGGCGTGCAGGGGGGCGCTTTTGAGGGCACCCACATGGGCCCGTTTGTGGAGCGGGGACCTGACGAGGCCATGGAGGACGGCGAGGAGGGCTCGGACGACGAGGCCGAGTGGGTGGTGACCAAGGACAAGTCCAAATACGACGAGATCTTCTACAACCTGGCGCCTGCCGACGGCAAGCTGAGCGGCTCCAAGGCCAAGACCTGGATGGTGGGGACCAAGCTCCCCAACTCAGTGCTGGGGCGCATCTGGAAGCTCAGCGATGTGGACCGCGACGGCATGCTGGATGATGAGGAGTTCGCGCTGGCCAGCCACCTCATCGAGGCCAAGCTGGAAGGCCACGGGCTGCCCGCCAACCTGCCCCGTCGCCTGGTGCCACCCTCCAAGCGACGCCACAAGGGCTCCGCCGAGTGAGCCGGCCCCCCTCCCATGGCCCTGCTGTGGCTCCCCAGCTCCAGTCGGCTGCACGCACACCCCTGCTCCGGCTCACACACGCCCTGCCTGCCCTCCCTGCCCAGCTGTAAGGACCGGGGGTCTCCCTCCTCACTACCGCCAGACACCCCGGTGGAAGCATTTAGAGGGGACCACGGGAGGGACAAGGCTTCTCTGTCCGCCCTTCACACCTCCAGCCTCACGTTCACTTAGGCACATCACACACACACTGGCACACGCAGGCATCCATCCATCCGTCATTCATTCAAATATTTATTGAGCACCTACTATGTGCCCAGCCCTGTTCTAGGCACTGGGCATTACCATAGAGAACAAAATAGACAAATACATCTGCCCTCATGGAAGGTGACGTTCCCAGGAGAGGGCACCTACACAGTCACGCAAACACACACTAATTCCTGGCAGGGCCCCCAGCCCCTCCCCTGGCTGAGCAGCCCTGTGGCTGAAATGACTAGCAGATAAACAGACCCCCTTCTGCTCCGCTTCCTCCTGCCCAGCCAGGCAACACCCTCAACCGGCTCCATCACATCCTCAGGTCTCGGGACCATGGGGGGCTCAGAGGGGAGACACACCTACTGCTTCCTCAGATGGGCCCCTCCGCAGCCCCTTCCCTTGCTCGGGGAAAGCCCCCAATTCTGCCCACACCCATTTATTTCCTTCCTTCCTTCCTTCT