Transcript asmbl_81728

Sequence
Transcript Sequence for observation asmbl_81728 of TGE0058708:
CGGGCTCAGTCTCCGCCGCCGCCGTGAACATGGAGCCCCCGGACGCACCGGCCCAGGCGCGCGGGGCCCCGCGGCTGCTGTTGCTCGCAGTCCTGCTGGCGGCGCACCCAGATGCCCAGGCGGAGGTGCGCTTGTCTGTACCCCCGCTGGTGGAGGTGATGCGAGGAAAGTCTGTCATTCTGGACTGCACCCCTACGGGAACCCACGACCATTATATGCTGGAATGGTTCCTTACCGACCGCTCGGGAGCTCGCCCCCGCCTAGCCTCGGCTGAGATGCAGGGCTCTGAGCTCCAGGTCACAATGCACGACACCCGGGGCCGCAGTCCCCCATACCAGCTGGACTCCCAGGGGCGCCTGGTGCTGGCTGAGGCCCAGGTGGGCGACGAGCGAGACTACGTGTGCGTGGTGAGGGCAGGGGCGGCAGGCACTGCTGAGGCCACTGCGCGGCTCAACGTGTTTGCAAAGCCAGAGGCCACTGAGGTCTCCCCCAACAAAGGGACACTGTCTGTGATGGAGGACTCTGCCCAGGAGATCGCCACCTGCAACAGCCGGAACGGGAACCCGGCCCCCAAGATCACGTGGTATCGCAACGGGCAGCGCCTGGAGGTGCCCGTAGAGATGAACCCAGAGGGCTACATGACCAGCCGCACGGTCCGGGAGGCCTCGGGCCTGCTCTCCCTCACCAGCACCCTCTACCTGCGGCTCCGCAAGGATGACCGAGACGCCAGCTTCCACTGCGCCGCCCACTACAGCCTGCCCGAGGGCCGCCACGGCCGCCTGGACAGCCCCACCTTCCACCTCACCCTGCACTATCCCACGGAGCACGTGCAGTTCTGGGTGGGCAGCCCGTCCACCCCAGCAGGCTGGGTACGCGAGGGTGACACTGTCCAGCTGCTCTGCCGGGGGGACGGCAGCCCCAGCCCGGAGTATACGCTTTTCCGCCTTCAGGATGAGCAGGAGGAAGTGCTGAATGTGAATCTCGAGGGGAACTTGACCCTGGAGGGAGTGACCCGGGGCCAGAGCGGGACCTATGGCTGCAGAGTGGAGGATTACGACGCGGCAGATGACGTGCAGCTCTCCAAGACGCTGGAGCTGCGCGTGGCCTATCTGGACCCCCTGGAGCTCAGCGAGGGGAAGGTGCTTTCCTTACCTCTAAACAGCAGTGCAGTCGTGAACTGCTCCGTGCACGGCCTGCCCACCCCTGCCCTACGCTGGACCAAGGACTCCACTCCCCTGGGCGATGGCCCCATGCTGTCGCTCAGTTCTATCACCTTCGATTCCAATGGCACCTACGTATGTGAGGCCTCCCTGCCCACAGTCCCGGTCCTCAGCCGCACCCAGAACTTCACGCTGCTGGTCCAAGGCTCGCCAGAGCTAAAGACAGCGGAAATAGAGCCCAAGGCAGATGGCAGCTGGAGGGAAGGAGACGAAGTCACACTCATCTGCTCTGCCCGCGGCCATCCAGACCCCAAACTCAGCTGGAGCCAATTGGGGGGCAGCCCCGCAGAGCCAATCCCCGGACGGCAGGGTTGGGTGAGCAGCTCTCTGACCCTGAAAGTGACCAGCGCCCTGAGCCGCGATGGCATCTCCTGTGAAGCCTCCAACCCCCACGGGAACAAGCGCCATGTCTTCCACTTCGGCACCGTGAGCCCCCAGACCTCCCAGGCTGGAGTGGCCGTCATGGCCGTGGCCGTCAGCGTGGGCCTCCTGCTCCTCGTCGTTGCTGTCTTCTACTGCGTGAGACGCAAAGGGGGCCCCTGCTGCCGCCAGCGGCGGGAGAAGGGGGCTCCGCCGCCAGGGGAGCCAGGGCTGAGCCACTCGGGGTCGGAGCAACCAGAGCAGACCGGCCTTCTCATGGGAGGTGCCTCCGGAGGAGCCAGGGGTGGCAGCGGGGGCTTCGGAGACGAGTGCTGAGCCAAGAACCTCCTAGAGGCTGTCCCTGGACCTGGAGCTGCAGGCATCAGAGAACCAGCCCTGCTCACGCCATGCCCGCCCCCGCCTTCCCTCTTCCCTCTTCCCTCTCCCTGCCCAGCCCTCCCTTCCTTCCTCTGCCGGCAAGGCAGGGACCCACAGTGGCTGCCTGCCTCCGGGAG