Transcript asmbl_81727

Sequence
Transcript Sequence for observation asmbl_81727 of TGE0058707:
CGGGCTCAGTCTCCGCCGCCGCCGTGAACATGGAGCCCCCGGACGCACCGGCCCAGGCGCGCGGGGCCCCGCGGCTGCTGTTGCTCGCAGTCCTGCTGGCGGCGCACCCAGATGCCCAGGCGGAGGTGCGCTTGTCTGTACCCCCGCTGGTGGAGGTGATGCGAGGAAAGTCTGTCATTCTGGACTGCACCCCTACGGGAACCCACGACCATTATATGCTGGAATGGTTCCTTACCGACCGCTCGGGAGCTCGCCCCCGCCTAGCCTCGGCTGAGATGCAGGGCTCTGAGCTCCAGGTCACAATGCACGACACCCGGGGCCGCAGTCCCCCATACCAGCTGGACTCCCAGGGGCGCCTGGTGCTGGCTGAGGCCCAGGTGGGCGACGAGCGAGACTACGTGTGCGTGGTGAGGGCAGGGGCGGCAGGCACTGCTGAGGCCACTGCGCGGCTCAACGTGTTTGCAAAGCCAGAGGCCACTGAGGTCTCCCCCAACAAAGGGACACTGTCTGTGATGGAGGACTCTGCCCAGGAGATCGCCACCTGCAACAGCCGGAACGGGAACCCGGCCCCCAAGATCACGTGGTATCGCAACGGGCAGCGCCTGGAGGTGCCCGTAGAGATGAACCCAGAGGGCTACATGACCAGCCGCACGGTCCGGGAGGCCTCGGGCCTGCTCTCCCTCACCAGCACCCTCTACCTGCGGCTCCGCAAGGATGACCGAGACGCCAGCTTCCACTGCGCCGCCCACTACAGCCTGCCCGAGGGCCGCCACGGCCGCCTGGACAGCCCCACCTTCCACCTCACCCTGCACTATCCCACGGAGCACGTGCAGTTCTGGGTGGGCAGCCCGTCCACCCCAGCAGGCTGGGTACGCGAGGGTGACACTGTCCAGCTGCTCTGCCGGGGGGACGGCAGCCCCAGCCCGGAGTATACGCTTTTCCGCCTTCAGGATGAGCAGGAGGAAGTGCTGAATGTGAATCTCGAGGGGAACTTGACCCTGGAGGGAGTGACCCGGGGCCAGAGCGGGACCTATGGCTGCAGAGTGGAGGATTACGACGCGGCAGATGACGTGCAGCTCTCCAAGACGCTGGAGCTGCGCGTGGCCTATCTGGACCCCCTGGAGCTCAGCGAGGGGAAGGTGCTTTCCTTACCTCTAAACAGCAGTGCAGTCGTGAACTGCTCCGTGCACGGCCTGCCCACCCCTGCCCTACGCTGGACCAAGGACTCCACTCCCCTGGGCGATGGCCCCATGCTGTCGCTCAGTTCTATCACCTTCGATTCCAATGGCACCTACGTATGTGAGGCCTCCCTGCCCACAGTCCCGGTCCTCAGCCGCACCCAGAACTTCACGCTGCTGGTCCAAGGCTCGCCAGAGCTAAAGACAGCGGAAATAGAGCCCAAGGCAGATGGCAGCTGGAGGGAAGGAGACGAAGTCACACTCATCTGCTCTGCCCGCGGCCATCCAGACCCCAAACTCAGCTGGAGCCAATTGGGGGGCAGCCCCGCAGAGCCAATCCCCGGACGGCAGGGTTGGGTGAGCAGCTCTCTGACCCTGAAAGTGACCAGCGCCCTGAGCCGCGATGGCATCTCCTGTGAAGCCTCCAACCCCCACGGGAACAAGCGCCATGTCTTCCACTTCGGCACCGTGAGCCCCCAGACCTCCCAGGCTGGAGTGGCCGTCATGGCCGTGGCCGTCAGCGTGGGCCTCCTGCTCCTCGTCGTTGCTGTCTTCTACTGCGTGAGACGCAAAGGGGGCCCCTGCTGCCGCCAGCGGCGGGAGAAGGGGGCTCCGTGAGTGGCCTGCTATCTGCAATGACCACCATAGCTTAACCCCATCCCCACCCTCAACCCCAAGCTCAACCCATAACCTCAACCACATCTTATCCTCCACCCCACATCCCACCACATCCACCTCCATCCCCAACCCATCCTCATCCCCAACTACAGCCCCAAACCCAGCCCCAGACTAATCCACAGCCATCCCCAACTCATCCTCATCCCCAACTGCAGCCCCAAACCCAACCCAGGGCCATCCCCAAACCCATCCCCAAGCCAAACTCAACACCATCCCCTTCCCTAATCACCTCTCCTGCCCCTAGCTCAGCCTCATCCCCAACTCCATGCCTGTCTCCAATCCCAACCCTGCCCCCAATCTCCCCTCAACTCCAATCCATAACCCCCTTCAAACCATCCTCAACTAAGCTCCTCTCCAGCCCTGGCCACATCCCCATCCTCCCCCAACCTCCAGCCCCAACACCCATCATCCCCCTGAGCTCACCCTTAACTCCAATTTATCCTCCAAGCCTATCTCTCACCATCCAGCCCTCACCTAGCCATTTCCCAACCCTAGTCCTCCACCGTCCCGAAGCCAACTTCACCCATGTCCCCATCCCCAATCTTGTCCCCATTCCTGACTCCAAATCCAACCCCTAAGCCTCCCCAAGCTCCTCCTCATCTAACCTTGTCTCCAGCCCCAACCACATGGCCGTCCTCACCTCCAATCCGTAACCATCCCAGACCGATCCCAAAGCCAACTCCAGCTACATTCCCACCTCCAACCCCAATAGCATCTGCATCCCCATGCCCAACCCTAACCCCAGTGCCATTACCAGCCCCTACCCCATCCCTATGCCATCCCCACCCAGCACACCCCCATCCTCACCTCCATCCCCAGCCGCATCCTAGTCCCACCCACCCCCATCCTCAGTTCCTCCCCCTGCCGTGTGCACCTCCAACACGACGCCTCCGCCCGCTGCCTCCTCCCCCCAGGCCGCCAGGGGAGCCAGGGCTGAGCCACTCGGGGTCGGAGCAACCAGAGCAGACCGGCCTTCTCATGGGAGGTGCCTCCGGAGGAGCCAGGGGTGGCAGCGGGGGCTTCGGAGACGAGTGCTGAGCCAAGAACCTCCTAGAGGCTGTCCCTGGACCTGGAGCTGCAGGCATCAGAGAACCAGCCCTGCTCACGCCATGCCCGCCCCCGCCTTCCCTCTTCCCTCTTCCCTCTCCCTGCCCAGCCCTCCCTTCCTTCCTCTGCCGGCAAGGCAGGGACCCACAGTGGCTGCCTGCCTCCGGGAG