Transcript asmbl_81527

Sequence
Transcript Sequence for observation asmbl_81527 of TGE0058232:
TACTGCACCCTGGGCCCCAGCGGACCATGGCATTAACTGCTCTCTCTCTCTCTCTCCTTCTCTCTTTCTCCCCTCGCCATCCCACCCCTGCCATCCTGTGTGCCATCTCATGGCTCTCTTGCCTCCCTGCCCACATCTCCCTGGACCCCTTCCCTTTTACCTGGTCTCTTGGGGCCGCTGTCTCCCTGCTCCCCGCCACTGTCCTGTCTGCCTGCTGTGCACATGGGGCGGCCCCTCTTGCCTACTCTGGGCCCGGCCTCCTCTGCTATGCCTGCGTCCTCGGAGCAGAAGCAGACAGGCAGCATGGACTCCGATGACTTCAGGGCTCTGCTTATCTCCACAGGATACAGCCTGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGGTGGGT