Transcript asmbl_80685

Sequence
Transcript Sequence for observation asmbl_80685 of TGE0056827:
CTTGCAGCCGGCGGCGCGGATTGAATGAGCCCGCCGAGCCCGGGCCGCCGTCGGGAGCAGCGCAGGCCGCGAGCCGCCGCCACCATGGCCACGCCGCTGCCCGGCCGCGCGGGCGGGCCCGCCACGCCGCTGTCGCCCACGCGCCTGTCGCGGCTGCAGGAGAAGGAGGAGCTGCGCGAGCTCAACGACCGCCTGGCGCACTACATCGACCGCGTCCGCGCGCTGGAGCTGGAGAACGACCGGCTCCTGCTCAAGATCTCAGAGAAGGAGGAGGTGACCACGCGCGAGGTGAGTGGCATCAAGGCGCTGTACGAGTCGGAGCTGGCCGATGCCCGGAGAGTCCTGGATGAGACGGCTCGAGAGCGTGCCCGGCTGCAGATAGAGATTGGGAAGCTGAGGGCAGAGTTGGACGAGGTCAACAAGAGCGCCAAGAAGAGGGAGGGCGAGCTTACGGTGGCCCAGGGCCGTGTGAAGGACCTGGAGTCCCTGTTCCACCGGAGCGAGGTGGAGCTGGCAGCTGCCCTCAGCGACAAGCGCGGCCTGGAGAGTGACGTGGCTGAGCTGCGGGCCCAGCTGGCCAAGGCCGAGGACGGTCATGCAGTGGCCAAAAAGCAGCTGGAGAAGGAGACGCTGATGCGTGTGGACCTGGAGAACCGCTGCCAGAGCCTGCAGGAGGAGCTGGACTTCCGGAAGAGTGTGTTCGAGGAGGAGGTGCGGGAGACGCGGCGGCGGCACGAGCGGCGCCTGGTGGAGGTGGACAGCAGCCGGCAGCAGGAGTACGACTTCAAGATGGCACAGGCGCTGGAGGAGCTGCGGAGCCAGCACGACGAGCAAGTGCGGCTCTACAAGCTGGAGCTGGAGCAGACCTACCAGGCCAAGCTGGACAGCGCCAAGCTGAGCTCTGACCAGAACGACAAGGCGGCCAGTGCGGCTCGCGAGGAGCTGAAGGAGGCCCGCATGCGCCTGGAGTCCCTCAGCTACCAGCTCTCCGGCCTCCAGAAGCAGGCCAGTGCCGCTGAAGATCGCATTCGGGAGCTGGAGGAGGCCATGGCCGGGGAGCGGGACAAGTTCCGGAAGATGCTGGACGCCAAGGAGCAGGAGATGACGGAGATGCGGGACGTGATGCAGCAGCAGCTGGCCGAGTACCAGGAGCTGCTGGACGTGAAGCTGGCCCTGGACATGGAGATCAACGCCTACCGGAAGCTCCTGGAGGGCGAGGAGGAGAGGCTGAAGCTGTCCCCCAGCCCATCCTCGCGCGTCACCGTCTCACGAGCCACCTCGAGCAGCAGCGGCAGCTTGTCCGCCACCGGGCGCCTGGGCCGCAGTAAGCGGAAGCGGCTGGAGGTGGAGGAGCCCTTGGGCAGCGGCCCAAGCGTCCTGGGCACGGGCACGGGTGGCAGCGGTGGCTTCCACCTGGCCCAGCAGGCCTCGGCCTCGGGTAGCGTCAGCATCGAGGAGATCGACCTGGAGGGCAAGTTTGTGCAGCTCAAGAACAACTCGGACAAGGATCAGTCTCTGGGGAACTGGAGAATCAAGAGGCAGGTCTTGGAGGGGGAGGAGATCGCCTACAAGTTCACGCCCAAGTACATCCTGCGCGCCGGCCAGATGGTCACGGTGTGGGCAGCTGGTGCGGGGGTGGCCCACAGCCCCCCCTCGACGCTGGTGTGGAAGGGCCAGAGCAGCTGGGGCACGGGCGAGAGCTTCCGCACCGTCCTGGTTAACGCGGATGGCGAGGAAGTGGCCATGAGGACTGTGAAGAAGTCCTCGGTGATGCGTGAGAATGAGAATGGGGAGGAAGAGGAGGAGGAAGCCGAGTTTGGCGAGGAGGATCTTTTCCACCAACAGGGGGACCCGAGGACCACCTCAAGAGGCTGCTACGTGATGTGAACCCACACTCCTCATCCACACACCTTTCTTTACCCAGAGCCACTGAAAACTATTTTTATATCATTGGCTTTCTTTAGTTCTTGATACATTTCTAGAGAATTTCTAAGCGAACTGCCAGAACGTGTGGGTGGGTCTCCCCCAGCCCTCCCTCCTGGCGGGTCTCCTCCAGCCTCACTTCGCTGCCACTTCGCCGCTGCCCCGGAGACTTTTCAATCCCACCCCACTCCTCATCTCACCATTTGGTCAAATTGGAAGCCCAGGGCCAGGACCCGGAGGTTTAGAAGATGCTTGGGCTTGGAGGGAGGAGGGCCGGCGAGGCTAGCGAGGGGACAGGAGACGGCCCTGCTGCGGACGGAGCGCGGAAACTGCGTAGGAATTCAGTGGTGGTGGGTTTTTTTAAGGCTTTCTACAAAACCAAATTCAGAATCCAGGCGTCGACCTGGTGGGGCCCGGGGCCAAGCCTGCATTCTGGCTGCCCAGCTTCGGACAGCGGGAACTCCTCAGGCAGCCACGCAGCGGGTGTGGGCCAGCATGGGGATGGCGTGGCCCCCAGGGCGGGTTTTCACTCCGCTGCCTGGGCTTCCAGATTCCCGTTCTGGCAGCGCACCGGCCGGGTTTCTCGGACCGTTGACTTTATTTGGGGGAGTTTTCCCGCAGTTCAGTTCCTGACTGTGCAAGGCCAACAGGGCAGGGGAGGGGAAGACCTGGGGAAGGAAGAATGAGGACAGTCCCGTCGTAAGACCTGTCACAACAATAAGCAGGGAGGGGAGATGTGGAGGGGACACATCTGGTTGCCTTGGAGGCAGAAGCTGTGAGTTTCAGAACAGCTGTCTGCAGGGAACGCCACCATGTTGACCCTCTGGAGGAGAGCGCTGTGGAGCCCCTCCCGTGTTCCAGCTCCGTCTGCCCTGTGCCTATATATACACATGCGTCTATCCATACTGTGCTTTTATCTGTGATTTTCTCGCTGAAACCATGTTTCTCAGACAGGCCAAGGCCACCTGACTCCTATCACGACGCACCCAAGCCCCTCAGTCCAGCTTCCCAATGCCTGGCACCCCCCTTCGGCAATAGCTCACCGTTTACACCCTCCCTCATAGATACACAGAAGTTATTTTTTTAATGGATATTTATTTTTTTACATTGGTCAGTACACAGGTCAGGAGCTCACGCCAGGGCCTTGAGGACAGGCTGACCCTCCTCCCCGGGGTGGCGTGGGGCTGGGGCACCCTCCGACGGCAGAGCCTCCTTCAGAAAGTGCAGCTCAAGTCTTAAAGACACCAAAACTGAGCCATGGGCACGCGCCGTCTCCGGGCCATGGCGTTCACTGCAGGGCGGGGGCGGCACCGCTCCCCTGTGACTGCATCCCGCCTCCCTGGGGACCTGCCTGTGGCAGGAAGGAATGGGGGGCCCCAGCCCCAGGCCGGGAAGGAGCCAGCGGCCGACAAAGCAGAAACACCCGCTGCTCCACGTAGCCCCTGCTCGCTGTCCTTGCTCTCAGAAGTCCCGGTCCCATGTAGATAGAGGGGGGCGCATCTTACCAAAGCATTTCCTCCTGGAGGCTACGCCGCTGTGCTCCCAGTCAGGCGGCTGGTAGGGAGCTTTGCCTGCCCCGGGGATACCCTCTGCCAGCCGCTGGAAGTGGGAATGCTGGCGACAGACTGTGTCCTCTTTCCCACCTTCATAGCAGGAATCACCCGGACCCGACTGGCTGGGCTTCGTGCTAGCGAGGGTTCTGGGGGTGGGTCTTGGTGATCTTGTCCTATGGGGAGTCTGCAGTGGTCTCAGCCACATCCTATGTATTTTGGCTCTGGAGGAGCAAAGCTGTATCCTGGAGTTGGTCTGTGATTTGCCGACAGCCTTGCAGGCTGGGCTCAGGGACAAAGTCCCCCCCAAAACCCGCAGGTCCTCATGTCCAGACGCTGCCCAGTCCTGTCCTGAAAACAGCACGCCCCAGGCCCACAGAACCCCCCACCCTACATTTGCCTTGGGTGGAGCTGGGGGTGGTCCTAGGACTGCGGGTGCCCTTAGCTGAAGGGGGTGGGGAGAAGCGTGGACTGGGCAGCCTGTGGGTAATTGGAGGTTCATTGAGAATTGAGTCTTTGGAAACACTAAGAAAATCAAATTTTTAAAAGTTATTTATGGCCTGGGAAACAATTTGCATTTGTCCCCAAATACGCTTAGCTGTGTGCCGCTTAGAACGATGCGAAACCATCCCTCTGTGTAAGCCCGTGCCGTGTGACTCGAAGCCTAGCGCCCTCCCTGCGAAGCATCAGACGCCACCCAGCCCTGGGGGGAGGCCCACGCCTGCTGGACCAACGCGGGTTCTGGGGTGCACAGCGCCAGGTTAACGCTGAAGCCTGCCCCGCTGAGCCCAGGAGCCGGGAGGCCTGCGGGCTGACCCAGAATCCGATCATGCACCTGTCCTCATGCCAGCGGCTTTGGCTGGGGTTGGTCTGAAGCCTGCACGCGGCAGTTCTTTGTTAAAGATCTGAGGGACTCCTCAGTCCTGGGGCGTCGCCGCCTGCAGCCTCTTCCAAGCCCTGCGTCCAGCGAGCGTCACAGCACAACCTGCAAAAACGGAGCTGGGCTGCAGCTGGGGCTGGCATGGACTTTCATTTCAGAGATTCGGTTTTTAAGAAGATGCATGCCTAATGTGTTCTTTTTTTTTTCCAATGATTTGTAATATACATTTTATGACTGGAAACTTTTTTGTACAACACTCCAATAAACATTTTGATTTTA