Transcript asmbl_80681

Sequence
Transcript Sequence for observation asmbl_80681 of TGE0058704:
AGTGCTGTGAACGTGGCCAAAGGGGGGCCGTCCAGGGGGGCCTGGACACCACCAAGACAGTGCTGACCGGAACCAAAGACGCAGTGTCCGCTGGGCTCATGGGGTCAGGGAACGTGGCGACAGGGGCCACCCACACTGGCCTCAGCACCTTCCAGAACTGGTTACCTAGTACCCCCGCCACCTCCTGGGGTGGACTCACCAGTTCCAGGACCACAGACAATGGTGGGGAGCAGACTGCCCTGAGCCCCCAAGAGGCCCCGTTCTCTGGCATCTCCACGCCCCCGGATGTGCTCAGTGTAGGCCCGGAGCCTGCCTGGGAAGCCGCAGCCACTACCAAGGGCCTTGCGACTGACGTGGCGACGTTCACCCAAGGGGCCGCCCCAGGCAGGGAGGACACGGGGCTTTTGGCCACCACACACGGCCCCGAAGAAGCCCCACGCTTGGCAATGCTGCAGAATGAGTTGGAGGGGCTGGGGGACATCTTCCACCCCATGAATGCGGAGGAGCAAGCTCAGCTGGCTGCCTCCCAGCCTGGGCCAAAGGTGCTGTCGGCGGAACAGGGGAGCTACTTCGTTCGTTTAGGTGACCTGGGTCCCAGCTTCCGCCAGCGGGCATTTGAACACGCGGTGAGCCACCTGCAGCACGGCCAGTTCCAAGCCAGGGACACTCTGGCCCAGCTCCAGGACTGCTTCAGGCTGATTGAAAAGGCCCAGCAGGCTCCAGAAGGGCAGCCACGTCTGGACCAGGGCTCAGGTGCCAGTGCGGAGGACGCTGCTGTCCAGGAGGAGCGGGATGCCGGGGTTCTGTCCAGGGTCTGCGGCCTTCTCCGGCAGCTGCACACGGCCTACAGTGGCCTGGTCTCCAGCCTCCAGGGCCTGCCCGCCGAGCTCCAGCAGCCAGTGGGGCGGGCGCGGCACAGCCTCTGTGAGCTCTATGGCATCGTGGCCTCAGCTGGCTCTGTAGAGGAGCTGCCCGCAGAGCGGCTGGTGCAGAGCCGCGAGGGTGTGCACCAGGCTTGGCAGGGGTTAGAGCAGCTGCTGGAGGGCCTACAGCACAATCCCCCGCTCAGCTGGCTGGTAGGGCCCTTCGCCTTGCCCGCTGGCGGGCAGTAGCTGTAGGAGCCTGCAGGCCCGGCGCGGGGTCGCCCTGCTCTGTCCAGGGAGGAGCTGCCTCAGAACTTTCTCCCCGCCCCCAAACCTGGATCGGTTCCCTAAAGCCCTAGACCTTTGGGGCTGCAGCTGGCTGAGCGCCGAGGGGCTGCGGAGGCAGTGACCTTCTTAACTGAGCCACCCCACGCCCTGCTCCGGGCCTGCCTGCATCTCCCACCTCCTCCCCAGCGCTGCCTGCCCCTCTCGGAGCCTGGGGTCACTCAGACCACCAGCCAAGAGCCTTCCCTTGAAGTCCCCAAGCAAGCACTGCAATTAGGAAAGAGAAAAAGCAGCGTGCCCAGCCTGGAAGGGCATCTGTTTGCCCCGCTAGCAACCCTTTTATATCTAGCAGGGCTCTTCCAGTCCTGCAGCACGGGCCCCCAGCTATCAGCGGTGCAGGCAGTGCTGTGGCATCCCAGGCTCCGGGCAGCTCCGTTCTCATGCTGAAAGTGGGTCTCCGGCCTTAGCACACACACCTTGAGGGTCTTAAGAACCACATTCCCTCATAGTAGAAAGTACTAGAAAAAGCGACACTGCCATCATCATCCCAAGGCAGGCTGCTACTGCCTTTGCTGACCCCCGGGGTGGCCTCACGGTGGGGACAAAGCTGCCAGGAGCCACAGCAGCCACAGCTGGGGCTTTGCACCAGCCTGGCTTGAGACTGAGCAGTTTGCAGGGGGTGGGGGGTGCAAAAAACAAGCAAACAGGCTGCTGCTGCCTCCAGCTGCCCACCACAGGCCTGCCCCAGGCACCTGGGGCTCTGAGGCCCCTGGGGAGGCTGGGCCCAGCAGCTGCCCCTGGAGAACACAGACAAAGGACTTCCCCGCAGGGAACTGTGCCCTATGGAGGGATCAGACAGGGCTGGGAACAGCCACAGAGGCTGCGTGCCTATGGCACAGCCCTTCCTCCGCCGCACACTCCCCCTGGGTCCTCAGGCCCACCCAAGCGCCGGGCTGCAGAGGAAGCGGGGCTGGGGAGGCTGCAGGCATCAGAGACACTGGTGGTGGCGGACCCGGCCGCCGGGCCCCGTGCTCTCAGGCTAGCCCAGGTCGTGGAGGCTGGCAGGCTCAGGTCGGGTGTGAGACGTGCCGTGGCTGCGCTCAGTCCAGCGGGGAGGAGCCGTTCAGCCCGGCCTCCCCAGGAAGCCATATCCCCACTCACCCGGTAAGAGAACCTTGTCGTCCCCTTTCCATGCTCTCCTAGGACACGAGCCCAGGAACCCCAGACCCAGGGGGAGGAAGGGTGGAGGGGCCCCAGGGGTCACCGTGTGCACCAGGGGCCGTGAGGGGCCGGGGCATTCAGCTCAGCTCTGAACCGGGGAAGCTGGCACGGCAAGGACTGCCTCAGGTGACGGGCCGTGAGAGGGGACGGGTCAGGAGCCTTCCCAAGCCTTCTCCTCAGCCCGACACCCATGGCCATCGGAGGCTAGGATGCCAGACACAGCCATTTGCAGAAATCAGGCACAGTGACTGCAGCTCACGTCCAGCCAACCAAGCATGGGGCCGCAGCTCAGGAAGTCCCTTCCCGCCACACCACAGCCTAATTCTTACTGGGACGGAGGCAACTCGGCTACGCTGGGCAGGACGACAAACACGAGACGCCACTGTGGAATGAGCAACTTCGGAGCACGGGGTGACTTGCTTGGGACCGTGCCCACGTGACAGCCCCTTATGCAGAGGAGGAAAGAGAAGCCCCGAGTGGGAGGGGAACCTGTCCAAAGTCACACGGTGTGTGGGTGACACAGCTGGGGTGAGTCGAGGCTGGCCCCTGAGGCCCATGCTCCCTGAACGCTGGAGACCACTGTCGGCTAGCAGCGGCTCTCAGGGAAGGCCTGGTCTCCACCCTCCCAGCCTAGCCTCGCGGACCCTCGTCCTCCCCACATCGGACCTGCTCACCTGCCTGGACCCTGGGCTGCCAGATGCAGGAAGCATCAAACCCCCCAGCCTCGTGGGTGCGGGGCAGGGCGCAGGCAGCACAGCTTAGATGCCCTGGTTTGTCCCTCTTGTCTCCTGGGAAGAGCTTGCTCCCGCCCAGCTCTCCTGCCACTGGCCTTTCAGGGTTGGGCTGGGCCCAGAGTGCCTTTTAGTCGCTTCTCACGGTGGCCTGATGGCTCAACCCAGTCCCAAACGGGCCCAGTGACACTGCCGCCTGCGCCCCAGCTCAGGCCCCCACTGCACCAGCAATGCTAGAAAACCAAGCCAATAAAAGTGATTTCTTTTTTCATTAAAAAACCA