Transcript asmbl_80154

Sequence
Transcript Sequence for observation asmbl_80154 of TGE0058703:
AAGGCAGAGGAGCCTGTAACAGGACTACCAGTTGAGCTGAGTCTGGGAGCAGGTGGGGGGCAGAGCAGGGAGCTGAGCCCTCTACTCTGTTTACAGCACGTGGTCCTCACTGATCTTTCTGGGTGGGAGGTGGCTTGTGCGGCTACACCCTGGGCAGGCCAGCCCCGCCCCCGGGTTTATTGCCCCAGGCTGCTACTGGCACAAGCCACAGACCAGCAGTCCCAGCCCAGGGAAGCTCGGAAGATGCCTAGGAGGGCCTCAAGGCTCATCCACAACATGGACCTGCGCACAATGACACAGTCGCTGGTGACTCTGGCGGAGGACAACATAGCCTTCTTCTCGAGCCAGGGTCCTGGGGAAACGGCCCAGCGGCTGTCAGGCGTTTTTGCCGGTGTACGGGAGCAGGCGCTGGGGCTGGAGCCGGCCCTGGGCCGCCTGCTGGGTGTGGCGCACCTCTTTGACCTGGACCCAGAGACACCGGCCAACGGGTACCGCAGCCTAGTGCACACAGCCCGCTGCTGCCTGGCGCACCTCCTGCACAAATCCCGCTATGTGGCCTCCAACCGCCGCAGCATCTTCTTCCGCACCAGCCACAACCTGGCCGAGCTGGAGGCCTACCTGGCTGCCCTCACCCAGCTCCGCGCTCTGGTCTACTACGCCCAGCGCCTGCTGGTTACCAATCGGCCGGGGGTACTCTTCTTTGAGGGCGACGAGGGGCTCACCGCCGACTTCCTCCGGGAGTATGTCACGCTGCATAAGGGATGCTTCTATGGCCGCTGCCTGGGCTTCCAGTTCACGCCTGCCATCCGGCCATTCCTGCAGACCATCTCCATTGGGCTGGTGTCCTTCGGGGAGCACTACAAACGCAACGAGACAGGCCTCAGTGTGGCCGCCAGCTCTCTCTTCACCAGCGGCCGCTTTGCCATCGACCCCGAGCTGCGTGGGGCTGAGTTTGAGCGGATCACACAGAACCTGGACGTGCACTTCTGGAAAGCCTTCTGGAACATCACCGAGATGGAAGTGCTATCGTCTCTGGCCAACATGGCATCGGCCACCGTGAGGGTAAGCCGCCTGCTCAGCCTGCCACCCGAAGCCTTTGAGATGCCACTGACTGCCGACCCCACGCTCACGGTCACCATCTCACCCCCACTGGCCCACACAGGCCCTGGGCCCGTCCTCGTCAGGCTCATCTCCTATGACCTGCGTGAAGGACAGGACAGTGAGGAGCTCAGCAGCCTGATAAAGTCCAACGGCCAACGGAGCCTGGAGCTGTGGCCGCGCCCCCAGCAGGCACCCCGCTCGCGGTCCCTGATAGTGCACTTCCACGGCGGTGGCTTTGTGGCCCAGACCTCCAGATCCCACGAGCCCTACCTCAAGAGCTGGGCCCAGGAGCTGGGCGCCCCCATCATCTCCATCGACTACTCCCTGGCCCCTGAGGCCCCCTTCCCCCGTGCGCTGGAGGAGTGCTTCTTCGCCTACTGCTGGGCCATCAAGCACTGCGCCCTCCTTGGCTCAACAGGGGAACGAATCTGCCTTGCGGGGGACAGTGCAGGCGGGAACCTCTGCTTCACCGTGGCTCTTCGGGCAGCAGCCTACGGGGTGCGGGTGCCAGATGGCATCATGGCAGCCTACCCGGCCACAATGCTGCAGCCTGCCGCCTCTCCCTCCCGCCTGCTGAGCCTCATGGACCCCTTGCTGCCCCTCAGTGTGCTCTCCAAGTGTGTCAGCGCCTATGCTGGTGCAAAGACGGAGGACCACTCCAACTCAGACCAGAAAGCCCTCGGCATGATGGGGCTGGTGCGGCGGGACACAGCCCTGCTCCTCCGAGACTTCCGCCTGGGTGCCTCCTCATGGCTCAACTCCTTCCTGGAGTTAAGTGGGCGCAAGTCCCAGAAGATGTCGGAGCCCATAGCAGAGCCGATGCGCCGCAGTGTGTCTGAAGCAGCACTGGCCCAGCCCCAGGGCCCACTGGGCACGGATTCCCTCAAGAACCTGACCCTGAGGGACTTGAGCCTGAGGGGAAACTCCGAGACGTCGTCGGACACCCCCGAGATGTCGCTGTCAGCTGAGACACTTAGCCCCTCCACACCCTCCGATGTCAACTTCTTATTACCACCTGAGGATGCAGGGGAAGAGGCTGAGGCCAAAAATGAGCTGAGCCCCATGGACAGAGGCCTGGGCGTCCGTGCCGCCTTCCCCGAGGGTTTCCACCCCCGACGCTCCAGCCAGGGTGCCACACAGATGCCCCTCTACTCCTCACCCATAGTCAAGAACCCCTTCATGTCGCCGCTGCTGGCACCCGACAGCATGCTCAAGAGCCTGCCACCTGTGCACATCGTGGCGTGCGCGCTGGACCCCATGCTGGACGACTCGGTCATGCTCGCGCGGCGACTGCGCAACCTGGGCCAGCCGGTGACGCTGCGCGTGGTGGAGGACCTGCCGCACGGCTTCCTGACCCTAGCGGCGCTGTGCCGCGAGACGCGCCAGGCCGCAGAGCTGTGCGTGGAGCGCATCCGCCTCGTCCTCACTCCTCCCGCCGGAGCCGGGCCGAGCGGGGAGACGGGGGCTGCGGGGGTAGACGGGGGCTGCGGGGGGCGACACTAAAAGCCTGTTGTTCCCATCTGCGCCGGCCTCCGTCATGAATGCCTTCCGGGCCGGGCGGAAGGGGACGCGGGCTGTGCCTTACTTAAGTCGGGGGTGGCAAGGGGGCGGGGCGGGGGCCCGAAAGCTGAGACCCTCGCCACGGGGAGGGGGACGCGCACACACACCGGTCACCGAGACGGCTGGACCTGCACGCCACCGCTGCCTTTTGCTGCTGCTGCTGCGGCGACCGCCGCAGGGACGGGGACTGGCCCTCCCTTGCAGGTCGGTTTGGTTTGTTGTAAATAAAAGTATTTAATTAGTTTGGCC