Transcript asmbl_79376

Sequence
Transcript Sequence for observation asmbl_79376 of TGE0058702:
CACTCCTCCCCATCCTCTCCCTCTGTCCCTCTGTCCCTCTGACCCTGCACTGTCCCAGCACCATGGGACCCACCTCAGGTCCCAGCCTGCTGCTCCTGCTACTAACCCACCTCCCCCTGGCTCTGGGGAGTCCCATGTACTCTATCATCACCCCCAACATCTTGCGGCTGGAGAGCGAGGAGACCATGGTGCTGGAGGCCCACGACGCGCAAGGGGATGTTCCAGTCACTGTTACTGTCCACGACTTCCCAGGCAAAAAACTAGTGCTGTCCAGTGAGAAGACTGTGCTGACCCCTGCCACCAACCACATGGGCAACGTCACCTTCACGATCCCAGCCAACAGGGAGTTCAAGTCAGAAAAGGGGCGCAACAAGTTCGTGACCGTGCAGGCCACCTTCGGGACCCAAGTGGTGGAGAAGGTGGTGCTGGTCAGCCTGCAGAGCGGGTACCTCTTCATCCAGACAGACAAGACCATCTACACCCCTGGCTCCACAGTTCTCTATCGGATCTTCACCGTCAACCACAAGCTGCTACCCGTGGGCCGGACGGTCATGGTCAACATTGAGAACCCGGAAGGCATCCCGGTCAAGCAGGACTCCTTGTCTTCTCAGAACCAGCTTGGCGTCTTGCCCTTGTCTTGGGACATTCCGGAACTCGTCAACATGGGCCAGTGGAAGATCCGAGCCTACTATGAAAACTCACCACAGCAGGTCTTCTCCACTGAGTTTGAGGTGAAGGAGTACGTGCTGCCCAGTTTCGAGGTCATAGTGGAGCCTACAGAGAAATTCTACTACATCTATAACGAGAAGGGCCTGGAGGTCACCATCACCGCCAGGTTCCTCTACGGGAAGAAAGTGGAGGGAACTGCCTTTGTCATCTTCGGGATCCAGGATGGCGAACAGAGGATTTCCCTGCCTGAATCCCTCAAGCGCATTCCGATTGAGGATGGCTCGGGGGAGGTTGTGCTGAGCCGGAAGGTACTGCTGGACGGGGTGCAGAACCCCCGAGCAGAAGACCTGGTGGGGAAGTCTTTGTACGTGTCTGCCACCGTCATCTTGCACTCAGGCAGTGACATGGTGCAGGCAGAGCGCAGCGGGATCCCCATCGTGACCTCTCCCTACCAGATCCACTTCACCAAGACACCCAAGTACTTCAAACCAGGAATGCCCTTTGACCTCATGGTGTTCGTGACGAACCCTGATGGCTCTCCAGCCTACCGAGTCCCCGTGGCAGTCCAGGGCGAGGACACTGTGCAGTCTCTAACCCAGGGAGATGGCGTGGCCAAACTCAGCATCAACACACACCCCAGCCAGAAGCCCTTGAGCATCACGGTGCGCACGAAGAAGCAGGAGCTCTCGGAGGCAGAGCAGGCTACCAGGACCATGCAGGCTCTGCCCTACAGCACCGTGGGCAACTCCAACAATTACCTGCATCTCTCAGTGCTACGTACAGAGCTCAGACCCGGGGAGACCCTCAACGTCAACTTCCTCCTGCGAATGGACCGCGCCCACGAGGCCAAGATCCGCTACTACACCTACCTGATCATGAACAAGGGCAGGCTGTTGAAGGCGGGACGCCAGGTGCGAGAGCCCGGCCAGGACCTGGTGGTGCTGCCCCTGTCCATCACCACCGACTTCATCCCTTCCTTCCGCCTGGTGGCGTACTACACGCTGATCGGTGCCAGCGGCCAGAGGGAGGTGGTGGCCGACTCCGTGTGGGTGGACGTCAAGGACTCCTGCGTGGGCTCGCTGGTGGTAAAAAGCGGCCAGTCAGAAGACCGGCAGCCTGTACCTGGGCAGCAGATGACCCTGAAGATAGAGGGTGACCACGGGGCCCGGGTGGTACTGGTGGCCGTGGACAAGGGCGTGTTCGTGCTGAATAAGAAGAACAAACTGACGCAGAGTAAGATCTGGGACGTGGTGGAGAAGGCAGACATCGGCTGCACCCCGGGCAGTGGGAAGGATTACGCCGGTGTCTTCTCCGACGCAGGGCTGACCTTCACGAGCAGCAGTGGCCAGCAGACCGCCCAGAGGGCAGAACTTCAGTGCCCGCAGCCAGCCGCCCGCCGACGCCGTTCCGTGCAGCTCACGGAGAAGCGAATGGACAAAGTCGGCAAGTACCCCAAGGAGCTGCGCAAGTGCTGCGAGGACGGCATGCGGGAGAACCCCATGAGGTTCTCGTGCCAGCGCCGGACCCGTTTCATCTCCCTGGGCGAGGCGTGCAAGAAGGTCTTCCTGGACTGCTGCAACTACATCACAGAGCTGCGGCGGCAGCACGCGCGGGCCAGCCACCTGGGCCTGGCCAGGAGTAACCTGGATGAGGACATCATTGCAGAAGAGAACATCGTTTCCCGAAGTGAGTTCCCAGAGAGCTGGCTGTGGAACGTTGAGGACTTGAAAGAGCCACCGAAAAATGGAATCTCTACGAAGCTCATGAATATATTTTTGAAAGACTCCATCACCACGTGGGAGATTCTGGCTGTGAGCATGTCGGACAAGAAAGGGATCTGTGTGGCAGACCCCTTCGAGGTCACAGTAATGCAGGACTTCTTCATCGACCTGCGGCTACCCTACTCTGTTGTTCGAAACGAGCAGGTGGAAATCCGAGCCGTTCTCTACAATTACCGGCAGAACCAAGAGCTCAAGGTGAGGGTGGAACTACTCCACAATCCAGCCTTCTGCAGCCTGGCCACCACCAAGAGGCGTCACCAGCAGACCGTAACCATCCCCCCCAAGTCCTCGTTGTCCGTTCCATATGTCATCGTGCCGCTAAAGACCGGCCTGCAGGAAGTGGAAGTCAAGGCTGCTGTCTACCATCATTTCATCAGTGACGGTGTCAGGAAGTCCCTGAAGGTCGTGCCGGAAGGAATCAGAATGAACAAAACTGTGGCTGTTCGCACCCTGGATCCAGAACGCCTGGGCCGTGAAGGAGTGCAGAAAGAGGACATCCCACCTGCAGACCTCAGTGACCAAGTCCCGGACACCGAGTCTGAGACCAGAATTCTCCTGCAAGGGACCCCAGTGGCCCAGATGACAGAGGATGCCGTCGACGCGGAACGGCTGAAGCACCTCATTGTGACCCCCTCGGGCTGCGGGGAACAGAACATGATCGGCATGACGCCCACGGTCATCGCTGTGCATTACCTGGATGAAACGGAGCAGTGGGAGAAGTTCGGCCTAGAGAAGCGGCAGGGGGCCTTGGAGCTCATCAAGAAGGGGTACACCCAGCAGCTGGCCTTCAGACAACCCAGCTCTGCCTTTGCGGCCTTCGTGAAACGGGCACCCAGCACCTGGCTGACCGCCTACGTGGTCAAGGTCTTCTCTCTGGCTGTCAACCTCATCGCCATCGACTCCCAAGTCCTCTGCGGGGCTGTTAAATGGCTGATCCTGGAGAAGCAGAAGCCCGACGGGGTCTTCCAGGAGGATGCGCCCGTGATACACCAAGAAATGATTGGTGGATTACGGAACAACAACGAGAAAGACATGGCCCTCACGGCCTTTGTTCTCATCTCGCTGCAGGAGGCTAAAGATATTTGCGAGGAGCAGGTCAACAGCCTGCCAGGCAGCATCACTAAAGCAGGAGACTTCCTTGAAGCCAACTACATGAACCTACAGAGATCCTACACTGTGGCCATTGCTGGCTATGCTCTGGCCCAGATGGGCAGGCTGAAGGGGCCTCTTCTTAACAAATTTCTGACCACAGCCAAAGATAAGAACCGCTGGGAGGACCCTGGTAAGCAGCTCTACAACGTGGAGGCCACATCCTATGCCCTCTTGGCCCTACTGCAGCTAAAAGACTTTGACTTTGTGCCTCCCGTCGTGCGTTGGCTCAATGAACAGAGATACTACGGTGGTGGCTATGGCTCTACCCAGGCCACCTTCATGGTGTTCCAAGCCTTGGCTCAATACCAAAAGGACGCCCCTGACCACCAGGAACTGAACCTTGATGTGTCCCTCCAACTGCCCAGCCGCAGCTCCAAGATCACCCACCGTATCCACTGGGAATCTGCCAGCCTCCTGCGATCAGAAGAGACCAAGGAAAATGAGGGTTTCACAGTCACAGCTGAAGGAAAAGGCCAAGGCACCTTGTCGGTGGTGACAATGTACCATGCTAAGGCCAAAGATCAACTCACCTGTAATAAATTCGACCTCAAGGTCACCATAAAACCAGCACCGGAAACAGAAAAGAGGCCTCAGGATGCCAAGAACACTATGATCCTTGAGATCTGTACCAGGTACCGGGGAGACCAGGATGCCACTATGTCTATATTGGACATATCCATGATGACTGGCTTTGCTCCAGACACAGATGACCTGAAGCAGCTGGCCAATGGTGTTGACAGATACATCTCCAAGTATGAGCTGGACAAAGCCTTCTCCGATAGGAACACCCTCATCATCTACCTGGACAAGGTCTCACACTCTGAGGATGACTGTCTAGCTTTCAAAGTTCACCAATACTTTAATGTAGAGCTTATCCAGCCTGGAGCAGTCAAGGTCTACGCCTATTACAACCTGGAGGAAAGCTGTACCCGGTTCTACCATCCGGAAAAGGAGGATGGAAAGCTGAACAAGCTCTGCCGTGATGAACTGTGCCGCTGTGCTGAGGAGAATTGCTTCATACAAAAGTCGGATGACAAGGTCACCCTGG