Transcript asmbl_78925

Sequence
Transcript Sequence for observation asmbl_78925 of TGE0057050:
CGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTTCCTCGGCGGGCCGGACTGGTCTCCAGAAATGCTTTGGGTTCATCTTTCATTGCTGCAAGGAACTTCCATGCCTCTAACACTCATCTTCAAAAGACTGGGACTGCTGAGATGTCCTCTATTCTTGAAGAGCGTATTCTTGGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGTATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCAGGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGAAATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTTCCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGAAAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATTCCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTGCCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCAATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAGAAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTGAAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCGGATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTTAGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCTTACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGATGTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGTGGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTACATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTCTACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCTGCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTATCGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTTTTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCTATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAGCCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAAGCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTGAAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAAACTCCTGTGGATTCACATCAAATACCAGTTCAGTTTTGTCATTGTTCTAGTAAATTAGTTCCATTTGTAAAAGGGTTACTCTCATACTCCTTATGTACAGAAATCACATGAAAAATAAAGGTTCCATAATGCA