Transcript asmbl_75301

Sequence
Transcript Sequence for observation asmbl_75301 of TGE0056824:
GCTCATTGGCCTGGGCGGCGCAGCCAAGCTGTCAGCCCATGTGGCGTGGCCGCCCGGGGATGGCCGCGGTTTAAATAGCGTCGGCGCCGGCCTAGAGGGAGCCAGAGAGACGGCAGCGGCCCCGGCCTCCCTCTCCGCCGCGCTTCAGCCTCCCGCTCCGCCGCGCTCCAGCCTCGCTCTCCGCCGCCCGCACCGCCGCCCGCGCCCTCACCAGAGCAGCCATGGAGGAGGTGGTGATTGCCGGCATGTCCGGGAAGCTGCCAGAGTCGGAGAACTTGCAGGAGTTCTGGGACAACCTCATCGGCGGTGTGGACATGGTCACGGACGATGACCGTCGCTGGAAGGCGGGGCTCTACGGCCTGCCCCGGCGGTCCGGCAAGCTGAAGGACCTGTCTAGGTTTGATGCCTCCTTCTTCGGAGTCCACCCCAAGCAGGCACACACGATGGACCCTCAGCTGCGGCTGCTGCTGGAAGTCACCTATGAAGCCATCGTGGACGGAGGCATCAACCCAGATTCACTCCGAGGAACACACACTGGCGTCTGGGTGGGCGTGAGCGGCTCTGAGACCTCGGAGGCCCTGAGCCGAGACCCCGAGACACTCGTGGGCTACAGCATGGTGGGCTGCCAGCGAGCGATGATGGCCAACCGGCTCTCCTTCTTCTTCGACTTCAGAGGGCCCAGCATCGCACTGGACACAGCCTGCTCCTCCAGCCTGATGGCCCTGCAGAACGCCTACCAGGCCATCCACAGCGGGCAGTGCCCTGCCGCCATCGTGGGGGGCATCAATGTCCTGCTGAAGCCCAACACCTCCGTGCAGTTCTTGAGGCTGGGGATGCTCAGCCCCGAGGGCACCTGCAAGGCCTTCGACACAGCGGGGAATGGGTACTGCCGCTCGGAGGGTGTGGTGGCCGTCCTGCTGACCAAGAAGTCCCTGGCCCGGCGGGTGTACGCCACCATCCTGAACGCCGGCACCAATACAGATGGCTTCAAGGAGCAAGGCGTGACCTTCCCCTCAGGGGATATCCAGGAGCAGCTCATCCGCTCGTTGTACCAGTCGGCCGGAGTGGCCCCTGAGTCATTTGAATACATCGAAGCCCACGGCACAGGCACCAAGGTGGGCGACCCCCAGGAGCTGAATGGCATCACCCGAGCCCTGTGCGCCACCCGCCAGGAGCCGCTGCTCATCGGCTCCACCAAGTCCAACATGGGGCACCCGGAGCCAGCCTCGGGGCTGGCAGCCCTGGCCAAGGTGCTGCTGTCCCTGGAGCACGGGCTCTGGGCCCCCAACCTGCACTTCCATAGCCCCAACCCTGAGATCCCAGCGCTGTTGGATGGGCGGCTGCAGGTGGTGGACCAGCCCCTGCCCGTCCGTGGCGGCAACGTGGGCATCAACTCCTTTGGCTTCGGGGGCTCCAACGTGCACATCATCCTGAGGCCCAACACGCAGCCGCCCCCCGCACCCGCCCCACATGCCACCCTGCCCCGTCTGCTGCGGGCCAGCGGACGCACCCCTGAGGCCGTGCAGAAGCTGCTGGAGCAGGGCCTCCGGCACAGCCAGGACCTGGCTTTCCTGAGCATGCTGAACGACATCGCGGCTGTCCCCGCCACCGCCATGCCCTTCCGTGGCTACGCTGTGCTGGGTGGTGAGCGCGGTGGCCCAGAGGTGCAGCAGGTGCCCGCTGGCGAGCGCCCGCTCTGGTTCATCTGCTCTGGGATGGGCACACAGTGGCGCGGGATGGGGCTGAGCCTCATGCGCCTGGACCGCTTCCGAGATTCCATCCTACGCTCCGATGAGGCTGTGAAGCCATTCGGCCTGAAGGTGTCACAGCTGCTGCTGAGCACAGACGAGAGCACCTTTGATGACATCGTCCATTCGTTTGTGAGCCTGACTGCCATCCAGATAGGCCTCATAGACCTGCTGAGCTGCATGGGGCTGAGGCCAGATGGCATCGTCGGCCACTCCCTGGGGGAGGTGGCCTGTGGCTACGCCGACGGCTGCCTGTCCCAGGAGGAGGCCGTCCTCGCTGCCTACTGGAGGGGACAGTGCATCAAAGAAGCCCATCTCCCGCCGGGCGCCATGGCAGCCGTGGGCTTGTCCTGGGAGGAGTGTAAACAGCGCTGCCCCCCGGGCGTGGTGCCCGCCTGCCACAACTCCAAGGACACAGTCACCATCTCGGGACCTCAGGCCCCGGTGTTTGAGTTCGTGGAGCAGCTGAGGAAGGAGGGTGTGTTTGCCAAGGAGGTGCGGACCGGCGGTATGGCCTTCCACTCCTACTTCATGGAGGCCATCGCACCCCCACTGCTGCAGGAGCTCAAGAAGGTGATCCGGGAGCCGAAGCCACGTTCAGCCCGCTGGCTCAGCACCTCTATCCCCGAGGCCCAGTGGCACAGCAGCCTGGCACGCACGTCCTCCGCCGAGTACAATGTCAACAACCTGGTGAGCCCTGTGCTGTTCCAGGAGGCCCTGTGGCACGTGCCTGAGCACGCGGTGGTGCTGGAGATCGCGCCCCACGCCCTGCTGCAGGCTGTCCTGAAGCGTGGCCTGAAGCCGAGCTGCACCATCATCCCCCTGATGAAGAAGGATCACAGGGACAACCTGGAGTTCTTCCTGGCCGGCATCGGCAGGCTGCACCTCTCAGGCATCGACGCCAACCCCAATGCCTTGTTCCCACCTGTGGAGTTCCCAGCTCCCCGAGGAACTCCCCTCATCTCCCCACTCATCAAGTGGGACCACAGCCTGGCCTGGGACGTGCCGGCCGCCGAGGACTTCCCCAACGGTTCAGGTTCCCCCTCAGCCGCCATCTACAACATCGACACCAGCTCCGAGTCTCCTGACCACTACCTGGTGGACCACACCCTCGACGGTCGCGTCCTCTTCCCCGCCACTGGCTACCTGAGCATAGTGTGGAAGACGCTGGCCCGCGCCCTGGGCCTGGGCGTCGAGCAGCTGCCTGTGGTGTTTGAGGATGTGGTGCTGCACCAGGCCACCATCCTGCCCAAGACTGGGACAGTGTCCCTGGAGGTACGGCTCCTGGAGGCCTCCCGTGCCTTCGAGGTGTCAGAGAACGGCAACCTGGTAGTGAGTGGGAAGGTGTACCAGTGGGATGACCCTGACCCCAGGCTCTTCGACCACCCGGAAAGCCCCACCCCCAACCCCACGGAGCCCCTCTTCCTGGCCCAGGCTGAAGTTTACAAGGAGCTGCGTCTGCGTGGCTACGACTACGGCCCTCATTTCCAGGGCATCCTGGAGGCCAGCCTGGAAGGTGACTCGGGGAGGCTGCTGTGGAAGGATAACTGGGTGAGCTTCATGGACACCATGCTGCAGATGTCCATCCTGGGCTCGGCCAAGCACGGCCTGTACCTGCCCACCCGTGTCACCGCCATCCACATCGACCCTGCCACCCACAGGCAGAAGCTGTACACACTGCAGGACAAGGCCCAAGTGGCTGACGTGGTGGTGAGCAGGTGGCTGAGGGTCACAGTGGCCGGAGGCGTCCACATCTCCGGGCTCCACACTGAGTCGGCCCCGCGGCGGCAGCAGGAGCAGCAGGTGCCCATCCTGGAGAAGTTTTGCTTCACTCCCCACACGGAGGAGGGGTGCCTGTCTGAGCGCGCTGCCCTGCAGGAGGAGCTGCAACTGTGCAAGGGGCTGGTGCAGGCACTGCAGACCAAGGTGACCCAGCAGGGGCTGAAGATGGTGGTGCCCGGACTGGATGGGGCCCAGATCCCCCGGGACCCCTCACAGCAGGAACTGCCCCGGCTGTTGTCGGCTGCCTGCAGGCTTCAGCTCAACGGGAACCTGCAGCTGGAGCTGGCGCAGGTGCTGGCCCAGGAGAGGCCCAAGCTGCCAGAGGACCCTCTGCTCAGCGGCCTCCTGGACTCCCCGGCACTCAAGGCCTGCCTGGACACTGCCGTGGAGAACATGCCCAGCCTGAAGATGAAGGTGGTGGAGGTGCTGGCTGGCCACGGTCACCTGTATTCCCGCATCCCAGGCCTGCTCAGCCCCCATCCCCTGCTGCAGCTGAGCTACACGGCCACCGACCGCCACCCCCAGGCCCTGGAGGCTGCCCAGGCCGAGCTGCAGCAGCACGACGTTGCCCAGGGCCAGTGGGATCCCGCAGACCCTGCCCCCAGCGCCCTGGGCAGCGCCGACCTCCTGGTGTGCAACTGTGCTGTGGCTGCCCTCGGGGACCCGGCCTCAGCTCTCAGCAACATGGTGGCTGCCCTGAGAGAAGGGGGCTTTCTGCTCCTGCACACACTGCTCCGGGGGCACCCCCTCGGGGACATCGTGGCCTTCCTCACCTCCACTGAGCCGCAGTATGGCCAGGGCATCCTGAGCCAGGACGCGTGGGAGAGCCTCTTCTCCAGGGTGTCGCTGCGCCTGGTGGGCCTGAAGAAGTCCTTCTACGGCTCCACGCTCTTCCTGTGCCGCCGGCCCACCCCGCAGGACAGCCCCATCTTCCTGCCGGTGGACGATACCAGCTTCCGCTGGGTGGAGTCTCTGAAGGGCATCCTGGCTGACGAAGACTCTTCCCGGCCTGTGTGGCTGAAGGCCATCAACTGTGCCACCTCGGGCGTGGTGGGCTTGGTGAACTGTCTCCGCCGAGAGCCCGGCGGGAACCGCCTCCGGTGTGTGCTGCTCTCCAACCTCAGCAGCACCTCCCACGTCCCGGAGGTGGACCCGGGCTCCGCAGAACTGCAGAAGGTGTTGCAGGGAGACCTGGTGATGAACGTCTACCGCGACGGGGCCTGGGGGGCTTTCCGCCACTTCCTGCTGGAGGAGGACAAGCCTGAGGAGCCGACGGCACATGCCTTTGTGAGCACCCTCACCCGGGGGGACCTGTCCTCCATCCGCTGGGTCTGCTCCTCGCTGCGCCATGCCCAGCCCACCTGCCCTGGCGCCCAGCTCTGCACGGTCTACTACGCCTCCCTCAACTTCCGCGACATCATGCTGGCCACTGGCAAGCTGTCCCCTGATGCCATCCCAGGGAAGTGGACCTCCCAGGACAGCCTGCTAGGTATGGAGTTCTCGGGCCGAGACGCCAGCGGCAAGCGTGTGATGGGACTGGTGCCTGCCAAGGGCCTGGCCACCTCTGTCCTGCTGTCACCGGACTTCCTCTGGGATGTGCCTTCCAACTGGACGCTGGAGGAGGCGGCCTCGGTGCCTGTCGTCTACAGCACGGCCTACTACGCGCTGGTGGTGCGTGGGCGGGTGCGCCCCGGGGAGACGCTGCTCATCCACTCGGGCTCGGGCGGCGTGGGCCAGGCCGCCATCGCCATCGCCCTCAGTCTGGGCTGCCGCGTCTTCACCACCGTGGGGTCGGCTGAGAAGCGGGCGTACCTCCAGGCCAGGTTCCCCCAGCTCGACAGCACCAGCTTCGCCAACTCCCGGGACACATCCTTCGAGCAGCATGTGCTGTGGCACACGGGCGGGAAGGGCGTTGACCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGCCCGGCCCACAAGAGCTACATCATCGCTGGTGGTCTGGGTGGCTTCGGCCTGGAGTTGGCGCAGTGGCTGATACAGCGTGGGGTGCAGAAGCTCGTGTTGACTTCTCGCTCCGGGATCCGGACAGGCTACCAGGCCAAGCAGGTCCGCCGGTGGAGGCGCCAGGGCGTACAGGTGCAGGTGTCCACCAGCAACATCAGCTCACTGGAGGGGGCCCGGGGCCTCATTGCCGAGGCGGCGCAGCTTGGGCCCGTGGGCGGCGTCTTCAACCTGGCCGTGGTCTTGAGAGATGGCTTGCTGGAGAACCAGACCCCAGAGTTCTTCCAGGACGTCTGCAAGCCCAAGTACAGCGGCACCCTGAACCTGGACAGGGTGACCCGAGAGGCGTGCCCTGAGCTGGACTACTTTGTGGTCTTCTCCTCTGTGAGCTGCGGGCGTGGCAATGCGGGACAGAGCAACTACGGCTTTGCCAATTCCGCCATGGAGCGTATCTGTGAGAAACGCCGGCACGAAGGCCTCCCAGGTGGGCCCCACCCTCTCCCCTCGACCCTGCCCACCCTGCCCTCTCCCAGTGTGGCCACTCCCCACCCCGACCTCCCCGCAGCTCTGCCCACCTGCCCCCTCCCCCACAGGCCTGGCCGTGCAGTGGGGC