Transcript asmbl_75300

Sequence
Transcript Sequence for observation asmbl_75300 of TGE0000941:
GCTCATTGGCCTGGGCGGCGCAGCCAAGCTGTCAGCCCATGTGGCGTGGCCGCCCGGGGATGGCCGCGGTTTAAATAGCGTCGGCGCCGGCCTAGAGGGAGCCAGAGAGACGGCAGCGGCCCCGGCCTCCCTCTCCGCCGCGCTTCAGCCTCCCGCTCCGCCGCGCTCCAGCCTCGCTCTCCGCCGCCCGCACCGCCGCCCGCGCCCTCACCAGAGCAGCCATGGAGGAGGTGGTGATTGCCGGCATGTCCGGGAAGCTGCCAGAGTCGGAGAACTTGCAGGAGTTCTGGGACAACCTCATCGGCGGTGTGGACATGGTCACGGACGATGACCGTCGCTGGAAGGCGGGGCTCTACGGCCTGCCCCGGCGGTCCGGCAAGCTGAAGGACCTGTCTAGGTTTGATGCCTCCTTCTTCGGAGTCCACCCCAAGCAGGCACACACGATGGACCCTCAGCTGCGGCTGCTGCTGGAAGTCACCTATGAAGCCATCGTGGACGGAGGCATCAACCCAGATTCACTCCGAGGAACACACACTGGCGTCTGGGTGGGCGTGAGCGGCTCTGAGACCTCGGAGGCCCTGAGCCGAGACCCCGAGACACTCGTGGGCTACAGCATGGTGGGCTGCCAGCGAGCGATGATGGCCAACCGGCTCTCCTTCTTCTTCGACTTCAGAGGGCCCAGCATCGCACTGGACACAGCCTGCTCCTCCAGCCTGATGGCCCTGCAGAACGCCTACCAGGCCATCCACAGCGGGCAGTGCCCTGCCGCCATCGTGGGGGGCATCAATGTCCTGCTGAAGCCCAACACCTCCGTGCAGTTCTTGAGGCTGGGGATGCTCAGCCCCGAGGGCACCTGCAAGGCCTTCGACACAGCGGGGAATGGGTACTGCCGCTCGGAGGGTGTGGTGGCCGTCCTGCTGACCAAGAAGTCCCTGGCCCGGCGGGTGTACGCCACCATCCTGAACGCCGGCACCAATACAGATGGCTTCAAGGAGCAAGGCGTGACCTTCCCCTCAGGGGATATCCAGGAGCAGCTCATCCGCTCGTTGTACCAGTCGGCCGGAGTGGCCCCTGAGTCATTTGAATACATCGAAGCCCACGGCACAGGCACCAAGGTGGGCGACCCCCAGGAGCTGAATGGCATCACCCGAGCCCTGTGCGCCACCCGCCAGGAGCCGCTGCTCATCGGCTCCACCAAGTCCAACATGGGGCACCCGGAGCCAGCCTCGGGGCTGGCAGCCCTGGCCAAGGTGCTGCTGTCCCTGGAGCACGGGCTCTGGGCCCCCAACCTGCACTTCCATAGCCCCAACCCTGAGATCCCAGCGCTGTTGGATGGGCGGCTGCAGGTGGTGGACCAGCCCCTGCCCGTCCGTGGCGGCAACGTGGGCATCAACTCCTTTGGCTTCGGGGGCTCCAACGTGCACATCATCCTGAGGCCCAACACGCAGCCGCCCCCCGCACCCGCCCCACATGCCACCCTGCCCCGTCTGCTGCGGGCCAGCGGACGCACCCCTGAGGCCGTGCAGAAGCTGCTGGAGCAGGGCCTCCGGCACAGCCAGGACCTGGCTTTCCTGAGCATGCTGAACGACATCGCGGCTGTCCCCGCCACCGCCATGCCCTTCCGTGGCTACGCTGTGCTGGGTGGTGAGCGCGGTGGCCCAGAGGTGCAGCAGGTGCCCGCTGGCGAGCGCCCGCTCTGGTTCATCTGCTCTGGGATGGGCACACAGTGGCGCGGGATGGGGCTGAGCCTCATGCGCCTGGACCGCTTCCGAGATTCCATCCTACGCTCCGATGAGGCTGTGAAGCCATTCGGCCTGAAGGTGTCACAGCTGCTGCTGAGCACAGACGAGAGCACCTTTGATGACATCGTCCATTCGTTTGTGAGCCTGACTGCCATCCAGATAGGCCTCATAGACCTGCTGAGCTGCATGGGGCTGAGGCCAGATGGCATCGTCGGCCACTCCCTGGGGGAGGTGGCCTGTGGCTACGCCGACGGCTGCCTGTCCCAGGAGGAGGCCGTCCTCGCTGCCTACTGGAGGGGACAGTGCATCAAAGAAGCCCATCTCCCGCCGGGCGCCATGGCAGCCGTGGGCTTGTCCTGGGAGGAGTGTAAACAGCGCTGCCCCCCGGGCGTGGTGCCCGCCTGCCACAACTCCAAGGACACAGTCACCATCTCGGGACCTCAGGCCCCGGTGTTTGAGTTCGTGGAGCAGCTGAGGAAGGAGGGTGTGTTTGCCAAGGAGGTGCGGACCGGCGGTATGGCCTTCCACTCCTACTTCATGGAGGCCATCGCACCCCCACTGCTGCAGGAGCTCAAGAAGGTGATCCGGGAGCCGAAGCCACGTTCAGCCCGCTGGCTCAGCACCTCTATCCCCGAGGCCCAGTGGCACAGCAGCCTGGCACGCACGTCCTCCGCCGAGTACAATGTCAACAACCTGGTGAGCCCTGTGCTGTTCCAGGAGGCCCTGTGGCACGTGCCTGAGCACGCGGTGGTGCTGGAGATCGCGCCCCACGCCCTGCTGCAGGCTGTCCTGAAGCGTGGCCTGAAGCCGAGCTGCACCATCATCCCCCTGATGAAGAAGGATCACAGGGACAACCTGGAGTTCTTCCTGGCCGGCATCGGCAGGCTGCACCTCTCAGGCATCGACGCCAACCCCAATGCCTTGTTCCCACCTGTGGAGTTCCCAGCTCCCCGAGGAACTCCCCTCATCTCCCCACTCATCAAGTGGGACCACAGCCTGGCCTGGGACGTGCCGGCCGCCGAGGACTTCCCCAACGGTTCAGGTTCCCCCTCAGCCGCCATCTACAACATCGACACCAGCTCCGAGTCTCCTGACCACTACCTGGTGGACCACACCCTCGACGGTCGCGTCCTCTTCCCCGCCACTGGCTACCTGAGCATAGTGTGGAAGACGCTGGCCCGCGCCCTGGGCCTGGGCGTCGAGCAGCTGCCTGTGGTGTTTGAGGATGTGGTGCTGCACCAGGCCACCATCCTGCCCAAGACTGGGACAGTGTCCCTGGAGGTACGGCTCCTGGAGGCCTCCCGTGCCTTCGAGGTGTCAGAGAACGGCAACCTGGTAGTGAGTGGGAAGGTGTACCAGTGGGATGACCCTGACCCCAGGCTCTTCGACCACCCGGAAAGCCCCACCCCCAACCCCACGGAGCCCCTCTTCCTGGCCCAGGCTGAAGTTTACAAGGAGCTGCGTCTGCGTGGCTACGACTACGGCCCTCATTTCCAGGGCATCCTGGAGGCCAGCCTGGAAGGTGACTCGGGGAGGCTGCTGTGGAAGGATAACTGGGTGAGCTTCATGGACACCATGCTGCAGATGTCCATCCTGGGCTCGGCCAAGCACGGCCTGTACCTGCCCACCCGTGTCACCGCCATCCACATCGACCCTGCCACCCACAGGCAGAAGCTGTACACACTGCAGGACAAGGCCCAAGTGGCTGACGTGGTGGTGAGCAGGTGGCTGAGGGTCACAGTGGCCGGAGGCGTCCACATCTCCGGGCTCCACACTGAGTCGGCCCCGCGGCGGCAGCAGGAGCAGCAGGTGCCCATCCTGGAGAAGTTTTGCTTCACTCCCCACACGGAGGAGGGGTGCCTGTCTGAGCGCGCTGCCCTGCAGGAGGAGCTGCAACTGTGCAAGGGGCTGGTGCAGGCACTGCAGACCAAGGTGACCCAGCAGGGGCTGAAGATGGTGGTGCCCGGACTGGATGGGGCCCAGATCCCCCGGGACCCCTCACAGCAGGAACTGCCCCGGCTGTTGTCGGCTGCCTGCAGGCTTCAGCTCAACGGGAACCTGCAGCTGGAGCTGGCGCAGGTGCTGGCCCAGGAGAGGCCCAAGCTGCCAGAGGACCCTCTGCTCAGCGGCCTCCTGGACTCCCCGGCACTCAAGGCCTGCCTGGACACTGCCGTGGAGAACATGCCCAGCCTGAAGATGAAGGTGGTGGAGGTGCTGGCTGGCCACGGTCACCTGTATTCCCGCATCCCAGGCCTGCTCAGCCCCCATCCCCTGCTGCAGCTGAGCTACACGGCCACCGACCGCCACCCCCAGGCCCTGGAGGCTGCCCAGGCCGAGCTGCAGCAGCACGACGTTGCCCAGGGCCAGTGGGATCCCGCAGACCCTGCCCCCAGCGCCCTGGGCAGCGCCGACCTCCTGGTGTGCAACTGTGCTGTGGCTGCCCTCGGGGACCCGGCCTCAGCTCTCAGCAACATGGTGGCTGCCCTGAGAGAAGGGGGCTTTCTGCTCCTGCACACACTGCTCCGGGGGCACCCCCTCGGGGACATCGTGGCCTTCCTCACCTCCACTGAGCCGCAGTATGGCCAGGGCATCCTGAGCCAGGACGCGTGGGAGAGCCTCTTCTCCAGGGTGTCGCTGCGCCTGGTGGGCCTGAAGAAGTCCTTCTACGGCTCCACGCTCTTCCTGTGCCGCCGGCCCACCCCGCAGGACAGCCCCATCTTCCTGCCGGTGGACGATACCAGCTTCCGCTGGGTGGAGTCTCTGAAGGGCATCCTGGCTGACGAAGACTCTTCCCGGCCTGTGTGGCTGAAGGCCATCAACTGTGCCACCTCGGGCGTGGTGGGCTTGGTGAACTGTCTCCGCCGAGAGCCCGGCGGGAACCGCCTCCGGTGTGTGCTGCTCTCCAACCTCAGCAGCACCTCCCACGTCCCGGAGGTGGACCCGGGCTCCGCAGAACTGCAGAAGGTGTTGCAGGGAGACCTGGTGATGAACGTCTACCGCGACGGGGCCTGGGGGGCTTTCCGCCACTTCCTGCTGGAGGAGGACAAGCCTGAGGAGCCGACGGCACATGCCTTTGTGAGCACCCTCACCCGGGGGGACCTGTCCTCCATCCGCTGGGTCTGCTCCTCGCTGCGCCATGCCCAGCCCACCTGCCCTGGCGCCCAGCTCTGCACGGTCTACTACGCCTCCCTCAACTTCCGCGACATCATGCTGGCCACTGGCAAGCTGTCCCCTGATGCCATCCCAGGGAAGTGGACCTCCCAGGACAGCCTGCTAGGTATGGAGTTCTCGGGCCGAGACGCCAGCGGCAAGCGTGTGATGGGACTGGTGCCTGCCAAGGGCCTGGCCACCTCTGTCCTGCTGTCACCGGACTTCCTCTGGGATGTGCCTTCCAACTGGACGCTGGAGGAGGCGGCCTCGGTGCCTGTCGTCTACAGCACGGCCTACTACGCGCTGGTGGTGCGTGGGCGGGTGCGCCCCGGGGAGACGCTGCTCATCCACTCGGGCTCGGGCGGCGTGGGCCAGGCCGCCATCGCCATCGCCCTCAGTCTGGGCTGCCGCGTCTTCACCACCGTGGGGTCGGCTGAGAAGCGGGCGTACCTCCAGGCCAGGTTCCCCCAGCTCGACAGCACCAGCTTCGCCAACTCCCGGGACACATCCTTCGAGCAGCATGTGCTGTGGCACACGGGCGGGAAGGGCGTTGACCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGCCCGGCCCACAAGAGCTACATCATCGCTGGTGGTCTGGGTGGCTTCGGCCTGGAGTTGGCGCAGTGGCTGATACAGCGTGGGGTGCAGAAGCTCGTGTTGACTTCTCGCTCCGGGATCCGGACAGGCTACCAGGCCAAGCAGGTCCGCCGGTGGAGGCGCCAGGGCGTACAGGTGCAGGTGTCCACCAGCAACATCAGCTCACTGGAGGGGGCCCGGGGCCTCATTGCCGAGGCGGCGCAGCTTGGGCCCGTGGGCGGCGTCTTCAACCTGGCCGTGGTCTTGAGAGATGGCTTGCTGGAGAACCAGACCCCAGAGTTCTTCCAGGACGTCTGCAAGCCCAAGTACAGCGGCACCCTGAACCTGGACAGGGTGACCCGAGAGGCGTGCCCTGAGCTGGACTACTTTGTGGTCTTCTCCTCTGTGAGCTGCGGGCGTGGCAATGCGGGACAGAGCAACTACGGCTTTGCCAATTCCGCCATGGAGCGTATCTGTGAGAAACGCCGGCACGAAGGCCTCCCAGGCCTGGCCGTGCAGTGGGGCGCCATCGGCGACGTGGGCATTTTGGTGGAGACGATGAGCACCAACGACACGATCGTCAGTGGCACGCTGCCCCAGCGCATGGCGTCCTGCCTGGAGGTGCTGGACCTCTTCCTGAACCAGCCCCACATGGTCCTGAGCAGCTTTGTGCTGGCTGAGAAGGCTGCGGCCTATAGGGACAGGGACAGCCAGCGGGACCTGGTGGAGGCCGTGGCACACATCCTGGGCATCCGCGACTTGGCTGCTGTCAACCTGGACAGCTCACTGGCGGACCTGGGCCTGGACTCGCTCATGAGCGTGGAGGTGCGCCAGACGCTGGAGCGTGAGCTCAACCTGGTGCTGTCCGTGCGCGAGGTGCGGCAACTCACGCTCCGGAAACTGCAGGAGCTGTCCTCAAAGGCGGATGAGGCCAGCGAGCTGGCATGCCCCACGCCCAAGGAGGATGGTCTGGCCCAGCAGCAGACTCAGCTGAACCTGCGCTCCCTGCTGGTGAACCCGGAGGGCCCCACCCTGATGCGGCTCAACTCCGTGCAGAGCTCGGAGCGGCCCCTGTTCCTGGTGCACCCAATCGAGGGCTCCACCACCGTGTTCCACAGCCTGGCCTCCCGGCTCAGCATCCCCACCTATGGCCTGCAGTGCACCCGAGCTGCGCCCCTTGACAGCATCCACAGCCTGGCTGCCTACTACATCGACTGCATCAGGCAGGTGCAGCCCGAGGGCCCCTACCGCGTGGCCGGCTACTCCTACGGGGCCTGCGTGGCCTTTGAAATGTGCTCCCAGCTGCAGGCCCAGCAGAGCCCAGCCCCCACCCACAACAGCCTCTTCCTGTTCGACGGCTCGCCCACCTACGTACTGGCCTACACCCAGAGCTACCGGGCAAAGCTGACCCCAGGCTGTGAGGCTGAGGCTGAGACGGAGGCCATATGCTTCTTCGTGCAGCAGTTCACGGACATGGAGCACAACAGGGTGCTGGAGGCGCTGCTGCCGCTGAAGGGCCTAGAGGAGCGTGTGGCAGCCGCCGTGGACCTGATCATCAAGAGCCACCAGGGCCTGGACCGCCAGGAGCTGAGCTTTGCGGCCCGGTCCTTCTACTACAAGCTGCGTGCCGCTGAGCAGTACACACCCAAGGCCAAGTACCATGGCAACGTGATGCTACTGCGCGCCAAGACGGGTGGCGCCTACGGCGAGGACCTGGGCGCGGACTACAACCTCTCCCAGGTATGCGACGGGAAAGTATCCGTCCACGTCATCGAGGGTGACCACCGCACGCTGCTGGAGGGCAGCGGCCTGGAGTCCATCATCAGCATCATCCACAGCTCCCTGGCTGAGCCACGCGTGAGCGTGCGGGAGGGCTAGGCCCGTGCCCCCGCCTGCCACCGGAGGTCACTCCACCATCCCCACCCCACCCCACCCCACC