Transcript asmbl_75052

Sequence
Transcript Sequence for observation asmbl_75052 of TGE0058700:
GGGAGGCGCTGTGCCCGCCCCCGGGAAGATACTTCCGGAACCAGCCCTCATCTCTATTGGCTGATCTGCGAAGCAAGGCCCACCCCCTTGGCTTTGGGGTTGGCTGAGGAAAGATCTTCCCGTGACCCACTTCCGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATCATACCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGAATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAATGTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGTTTAATGCGCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAAAAGAAGATGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAAGAGATGGAGAAGATGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTCCCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAAAATTGAGTCCAGGAGGAAGCTCTGGCCCTTGTATTACACATTCTGGACATTAAAAATAATAATTATACAGT