Transcript asmbl_74962

Sequence
Transcript Sequence for observation asmbl_74962 of TGE0058699:
TCAAGCTGCCATTAATGCTGCTATTATAGAAATCACAACAAATCACTCAGTGATGGAGGAGCTGATGTCAGTTACTGGAAAAAATATGAAGATGCATTCCTTCATTGGTCAATCAGGAGTTATAACTGATTTGTACCTTTTTTCCTGCATTATTTCATTTTCCTCATTCATTTACTATGCATCTGTTAATGTCACAAGAGAGAGGAAAAGGATGAAGGCCTTGATGACAATGATGGGTCTTCGGGATTCAGCGTTCTGGCTCTCCTGGGGTTTGCTCTATGCTGGTTTCATCTTCATTATGGCCCTTTTCTTGGCACTTGTTATAAGATCTACCCAGTTTATCATTTTGTCTGGCTTCATGGTAGTCTTCAGCCTCTTTCTCCTGTATGGATTATCTTTGGTAGCTTTGGCTTTCTTAATGAGCATCTTGGTAAAGAAATCTTTCCTCACCGGCCTGGTCGTGTTCCTCCTCACTGTCTTTTGGGGGTGTCTGGGGTTCACATCACTGTACAGACACCTTCCTGCATCCTTGGAGTGGATTTTAAGCTTGCTTAGTCCCTTTGCCTTCATGCTTGGAATGGCCCAGCTTTTACACTTGGACTATGATTTGAATTCTAATGCATTTCCTCATCCATCGGACGGCTCAAATCTCATTGTAGCAACAAATTTCATGTTGGCATTTGACACTTGCCTCTATCTGGCATTGGCGATTTACTTTGAAAAAATTTTGCCAAATGAATATGGACATCGACGTCCACCTTTGTTTTTCCTGAAGTCCTCATTTTGGTCTCAAACACAAAAGACTGATCACGTGGCCCTTGAAGATGAAATGGATGCCGATCCTTCATTTCATGACTCTTTTGAACAAGCGCCTCCAGAATTCCAAGGGAAAGAAGCCATCAGAATCAGAAATGTTACAAAAGAATATAAAGGAAAGCCTGATAAAATAGAAGCCTTGAAAGATCTGGTATTTGACATTTACGAAGGCCAAATCACTGCAATACTTGGTCACAGTGGAGCTGGAAAGTCAACACTGCTAAACATTCTTAGTGGGTTGTCTGTTCCCACCAAAGGTTCAGTCACCATCTATAACAATAAGCTTTCAGAAATGGCTGACCTAGAAAATCTCAGCAAGCTGACCGGAGTTTGTCCACAATCCAATGTGCAATTTGACTTCCTCACTGTAAGAGAAAACCTCAGACTCTTTGCTAAAATAAAAGGGATTCTGCCACAAGAAGTGGATAAAGAGATACAAAGGGTTCTGCTGGAATTGGAAATGAAAAATATTCAGGATGTTCTTGCTCAAAACTTAAGTGGTGGACAGAAAAGAAAGCTAACCTTTGGGATTGCCATTTTAGGAGATCCTCAGATTTTCCTGTTGGATGAACCAACTGCTGGATTGGATCCCTTTTCAAGACACCAAGTATGGAACCTTCTGAAAGAACGCAAAACAGACCGCGTGATCCTCTTCAGTACCCAGTTCATGGATGAGGCCGACATCCTGGCGGACAGGAAAGTATTTCTCTCCCAAGGGAAGCTAAAGTGCGCGGGCTCTTCTTTGTTTCTAAAGAAGAAATGGGGGATTGGATATCACTTAAGCTTGCAGTTAAATGAAATATGTGTTGAGGAAAACATAACATCACTTGTTAAACAGCACATCCCTGATGCCAAATTATCAGCCAAAAGCGAAGGAAAACTTATTTATACATTACCCTTAGAAAGAACAAATAAATTTCCAGAACTTTACAAGGATCTTGATAGCTATCCTGACCTAGGAATTGAGAATTATGGTGTTTCCATGACAACTTTGAATGAAGTATTCCTGAAGCTAGAAGGAAAATCTACAATTAATGAATCGGACATTGCTATTTTGGGAGAAGTACAAGCGGAAAAAGCTGACGACACTGAAAGGCTTGTTGAGATGGAACAAGTCCTCTCTTCACTTAACAAGATGAGAAAGACAATAGGTGGTGTGGCTCTCTGGCGACAGCAAATCTGCGCAATTGCAAGGGTTCGCTTGTTAAAGTTAAAGCATGAAAGAAAAGCTCTTTTAGCACTGCTATTAATTCTAATGGCTGGATTTTGCCCTCTTCTTGTGGAGTATACCATGGTGAAAATATATCAAAACAGTTACACCTGGGAACTTTCTCCTCATTTGTATTTCCTTGCTCCTGGACAACAACCACATGACCCTCTCACTCAACTACTGATCATCAATAAAACAGGGGCAAGCATTGATGACTTTATACAGTCTGTGGAGCACCAGAACATAGCTTTAGAAGTGGATGCATTTGGAACTAGAAATGGCACAGATGACCCATCTTATAATGGAGCCATCACAGTGTGTTGTAATGAAAAGAATTACAGCTTTTCGTTAGCATGCAATGCCAAAAGATTGAATTGCTTCCCAGTTCTTATGGACATTGTTAGTAATGGGCTACTTGGAATGGTTAAACCATCAGTACATATCCGAACTGAAAGAAGTACATTTTTGGAGAATGGACAGGACAATCCAATCGGATTCCTGGCATATATCATGTTCTGGCTGGTTTTAACATCGAGTTGCCCACCTTACATTGCCATGAGCAGCATCGATGATTATAAGAACAGAGCTCGGTCCCAGCTACGGATTTCCGGACTCTCCCCTTCTGCTTACTGGTTTGGGCAGGCGCTGGTGGATGTTTCCCTGTACTTCTTGGTCTTCGTTTTTATATATTTAATGAGCTACATTTCAAACTTCGAAGACATGCTACTTACAATAATTCATATTATTCAAATCCCATGTGCTGTTGGTTATTCCTTTTCCCTCATCTTCATGACATACGTGATTTCCTTCATCTTTCGCAAGGGGAGAAAAAATAGTGGCATTTGGTCATTTTGTTTCTATGTTGTCACTGTATTCTCTGTGGCTGGATTTGCGTTCAGTATCTTCGAAAGTGATATTCCATTTATCTTCACTTTTTTAATACCACCTGCCACAATGATTGGCTGTTTGTTCTTATCTTCTCATCTTCTCTTTTCTTCTCTCTTTTCTGAAGAACGAATGGATGTACAGCCATTTCTGGTATTCCTAATTCCTTTCCTTCATTTTATCATTTTTCTTTTTACTCTTCGATGTCTGGAATGGAAGTTTGGAAAGAAATCAATGAGAAAGGATCCTTTCTTTAGAATTTCTCCAAGAAGTAGTGATGTGTGTCAAAATCCAGAAGAACCAGAAGGAGAGGATGAAGATGTTCAGATGGAAAGAGTGAGAACAGCAAATGCCTTGAATTCTACTAATTTTGATGAGAAGCCAGTCATCATTGCCAGCTGTCTACGCAAGGAGTATGCAGGGAAGAGGAAAGGCTGTTTTTCCAAGAGGAAGAATAAGATAGCCACGAGAAATGTCTCCTTCTGTGTTAGAAAAGGTGAAGTTTTAGGATTATTAGGACACAATGGAGCTGGTAAAAGCACATCCATTAAGGTGATAACTGGAGACACAAAACCAACTGCTGGACAAGTGCTACTGAAAGGGAGCGGTGGAGGGGATGCCCTGGAGTTCCTGGGGTACTGCCCTCAGGAGAACGCGCTGTGGCCCAACCTGACAGTGAGGCAGCACCTGGAGGTGTACGCCGCCGTGAAAGGGCTGAGGAAAGGGGATGCTGAGGTTGCCATCACACGGTTAGTGGATGCGCTCAAGCTGCAGGACCAGCTGAAGTCTCCCGTGAAGACCTTGTCAGAGGGAATAAAGAGAAAGCTGTGCTTTGTCCTGAGCATACTGGGGAACCCGTCAGTGGTGCTTCTGGATGAGCCGTCGACCGGGATGGACCCCGAGGGGCAGCAGCAAATGTGGCAGGCCATCCGGGCCACCTTTAGAAACACGGAAAGGGGTGCCCTCCTAACCACCCACTACATGGCAGAGGCTGAGGCCGTGTGTGACCGAGTGGCCATCATGGTATCTGGGAGGTTGAGATGTATCGGTTCCATCCAACACCTGAAAAGCAAATTTGGCAAAGATTACCTGCTGGAGATGAAGGTGAAGAACCTGGCACAAGTGGAGCCCCTCCATGCAGAGATCCTGAGGCTTTTCCCCCAGGCTGCTCGGCAGGAAAGGTACTCCTCTCTGATGGTTTATAAGTTGCCAGTGGAAGATGTGCAACCTTTAGCCCAAGCTTTCTTCAAATTAGAGAAGGTTAAACAGAGCTTTGACCTAGAGGAGTACAGCCTCTCACAGTCTACCCTGGAGCAG