Transcript asmbl_74885

Sequence
Transcript Sequence for observation asmbl_74885 of TGE0058698:
CATCACTTTAACTCCATGAGCATCGAAGCTTCTGGAATCAACATGTTTCTTATGTTTCTTGCAGGTTCAAGCCTTGAGGGTCAAGAAAACTCTTTCACAATCAACAGTGTTGACATGAAGAGCCTGCCGGACTGGACGGTGCAAAATGGGAAGAACCTGACCCTGCAGTGCTTCGCGGATGTCAGCACCACCTCTCACGTCAAGCCTCAGCACCAGATGCTGTTCTATAAGGATGACGTGCTGTTTTACAACATCTCCTCCATGAAGAGCACAGAGAGTTATTTTATTCCTGAAGTCCGGATCTATGACTCAGGGACATATAAATGTACTGTGATTGTGAACAACAAAGAGAAAACCACTGCAGAGTACCAGGTGTTGGTGGAAGGAGTGCCCAGTCCCAGGGTGACACTGGACAAGAAAGAGGCCATCCAAGGTGGGATCGTGAGGGTCAACTGTTCTGTCCCAGAGGAAAAGGCCCCAATACACTTCACAATTGAAAAACTTGAACTAAATGAAAAAATGGTCAAGCTGAAAAGAGAGAAGAATTCTCGAGACCAGAATTTTGTGATACTGGAATTCCCCGTTGAGGAACAGGACCGCGTTTTATCCTTCCGATGTCAAGCTAGGATCATTTCTGGGATCCATATGCAGACCTCAGAATCTACCAAGAGTGAACTGGTCACCGTGACGGAATCCTTCTCTACACCCAAGTTCCACATCAGCCCCACCGGAATGATCATGGAAGGAGCTCAGCTCCACATTAAGTGCACCATTCAAGTGACTCACCTGGCCCAGGAGTTTCCAGAAATCATAATTCAGAAGGACAAGGCGATTGTGGCCCACAACAGACATGGCAACAAGGCTGTGTACTCAGTCATGGCCATGGTGGAGCACAGTGGCAACTACACGTGCAAAGTGGAGTCCAGCCGCATATCCAAGGTCAGCAGCATCGTGGTCAACATAACAGAACTATTTTCCAAGCCCGAACTGGAATCTTCCTTCACACATCTGGACCAAGGTGAAAGACTGAACCTGTCCTGCTCCATCCCAGGAGCACCTCCAGCCAACTTCACCATCCAGAAGGAAGATACGATTGTGTCACAGACTCAAGATTTCACCAAGATAGCCTCAAAGTCGGACAGTGGGACGTATATCTGCACTGCAGGTATTGACAAAGTGGTCAAGAAAAGCAACACAGTCCAGATAGTCGTATGTGAAATGCTCTCCCAGCCCAGGATTTCTTATGATGCCCAGTTTGAGGTCATAAAAGGACAGACCATCGAAGTCCGTTGCGAATCGATCAGTGGAACTTTGCCTATTTCTTACCAACTTTTAAAAACAAGTAAAGTTTTGGAGAATAGTACCAAGAACTCAAATGATCCTGCGGTATTCAAAGACAACCCCACTGAAGACGTCGAATACCAGTGTGTTGCAGATAATTGCCATTCCCATGCCAAAATGTTAAGTGAGGTTCTGAGGGTGAAGGTGATAGCCCCGGTGGATGAGGTCCAGATTTCTATCCTGTCAAGTAAGGTGGTGGAGTCTGGAGAGGACATTGTGCTGCAATGTGCTGTGAATGAAGGATCTGGTCCCATCACCTATAAGTTTTACAGAGAAAAAGAGGGCAAACCCTTCTATCAAATGACCTCAAATGCCACCCAGGCATTTTGGACCAAGCAGAAGGCTAGCAAGGAACAGGAGGGAGAGTATTACTGCACAGCCTTCAACAGAGCCAACCACGCCTCCAGTGTCCCCAGAAGCAAAATACTGACAGTCAGAGTCATTCTTGCCCCATGGAAGAAAGGACTTATTGCAGTGGTTATCATCGGAGTGATCATTGCTCTCTTGATCATTGCGGCCAAATGTTATTTTCTGAGGAAAGCCAAGGCCAAGCAGATGCCAGTGGAAATGTCCAGGCCAGCAGTACCACTTCTGAACTCCAACAACGAGAAAATGTCAGATCCCAATATGGAAGCTAACAGTCATTACGGTCACAATGACGATGTCAGAAACCATGCAATGAAACCAATAAATGATAATAAAGAGCCTCTGAACTCAGACGTGCAGTACACGGAAGTTCAAGTGTCCTCAGCTGAGTCTCACAAAGATCTAGGAAAGAAGGACACAGAGACAGTGTACAGTGAAGTCCGGAAAGCTGTCCCTGATGCCGTGGAAAGCAGATACTCTAGAACGGAAGGCTCCCTTGATGGAACTTAGACAGCAAGGCCAGATGCACATCCCTGGAAGGACATCCATGTTCCGAGAAGAACAGATAATCCCTGTATTTCAAGACCTCTGTGCACTTATTTATGAACCTGCCCTGCTCCCACAGAACACAGCAATTCCTCAGGCTAAGCTGCCGGTTCTTAAATCCATCCTGCTAAGTTAATGTTGGGTAGAAAGAGATACAGAGGGGCTGTTGAATTTCCCACATACCCTCCTTCCACCAAGTTGGAACATCCTTGGAAATTGGAAGAGCACAAGAGGAGATCCAGGGCAAGGCCATTGGGATATTCTGAAACTTGAATATTTTGTTTTGTGCAGAGATAAAGACCTTTTCCATGCACCCTCATACACAGAAACCAATTTTCTTTTTTATACTCAATCATTTCTAGCGCATGGCCTGGTTAGAGGCTGGTTTTTTCTCTTTTCCTTTGGTCCTTCAAAGGCTTGTAGTTTTGGCTAGTCCTTGTTCTTTGGAAATACACAGTGCTGACCAGACAGCCTCCCCCTGTCCCCTCTATGACCTCGCCCTCCACAAATGGGAAAACCAGACTACTTGGGAGCACCGCCTGTGAAATACCAACCTGAAGACACCGTTCATTCAGGCAACGCACAAAACAGAAAATGAAGGTGGAACAAGCACAGATGTTCTTCAACTGTTTTTGTCTACACTCTTTCTCTTTTCCTCTACCATGCTGAAGGCTGAAAGACAGGAAGATGGTGCCATCAGCAAATATTATTCTTAATTGAAAACTTGAAATGTGTATGTTTCTTACTAATTTTTAAAAATGTATTCCTTGCCAGGGCAGGCAAGGTGGCTCACGCCTGTAATCCCA