Transcript asmbl_74553

Sequence
Transcript Sequence for observation asmbl_74553 of TGE0056267:
GCCCCTCCCGCTGGATCCCGCAGCCGCGGCTCTTCCCGACGCGTTCCGCCTTCCCCAGCTGTGCACTCTCCATCCAGCTGTGCGCTCTCGTCGGGAGTCCCAGCCATGTCCGACGAGAGAGAGGTAGCCGAGGCAGCGACCGGGGAAGACGCCTCTTCGCCGCCTCCGAAAACCGAGGCAGCGAGCGACCCCCAGCATCCCGCGGCCTCCGAAGGGGCCGCCGCCGCCGCCGCCTCGCCGCCACTGCTGCGCTGCCTAGTGCTCACCGGCTTTGGAGGCTACGACAAGGTGAAGCTGCAGAGCCGGCCGGCAGCGCCCCCGGCCCCTGGGCCCGGCCAGCTGACGCTGCGTCTGCGGGCCTGCGGGCTCAACTTCGCAGACCTCATGGCTAGGCAGGGGCTGTACGACCGTCTCCCGCCTCTGCCTGTCACTCCGGGCATGGAGGGCGCGGGTGTTGTGATCGCAGTGGGCGAGGGAGTCAGCGACCGCAAGGCAGGAGACCGGGTGATGGTGTTGAACCGGTCAGGGATGTGGCAGGAAGAGGTGACTGTGCCCTCGGTCCAGACCTTCCTGATTCCTGAGGCCATGACCTTTGAGGAAGCTGCTGCCTTGCTCGTCAATTACATTACAGCCTACATGGTCCTCTTTGACTTCGGCAACCTACAGCCTGGCCACAGCGTCTTGGTACACATGGCTGCAGGGGGTGTGGGTATGGCTGCCGTGCAGCTGTGCCGTACAGTGGAGAATGTGACAGTGTTCGGAACGGCCTCGGCCAGCAAGCACGAGGCACTGAAGGAGAATGGGGTCACACATCCCATCGACTATCACACGACTGACTACGTGGATGAGATCAAGAAGATTTCCCCTAAAGGAGTGGACATTGTCATGGACCCTCTGGGTGGGTCAGATACTGCCAAGGGCTACAACCTCCTGAAACCCATGGGCAAAGTCGTCACCTATGGAATGGCCAACCTGCTGACGGGCCCCAAACGGAACCTGATGGCCCTGGCCCGGACATGGTGGAATCAGTTCAGCGTGACAGCTCTGCAGCTGCTGCAGGCCAACCGGGCTGTGTGTGGCTTCCACCTGGGCTACCTGGATGGTGAGGTGGAGCTGGTCAGTGGTGTGGTGGCCCGCCTCCTGGCTCTGTACAACCAGGGCCACATCAAGCCCCACATTGACTCAGTCTGGCCCTTCGAGAAGGTGGCTGATGCCATGAAACAGATGCAGGAGAAGAAGAATGTGGGCAAGGTCCTCCTGGTTCCAGGGCCAGAGAAGGAGAACTAGGGCAAGTGGCTGTGAGACCCTAGAGACCAGCGAAGGGAGAAGTTGGGAAGCTACGTTCTGTTGGCCACCAGACTTGCATTTCAGCCTCTGTCATAATGCTCTGCCCTCCCTCCCCCGAAGGTCTCTGTGGTGATGACCGCTCTCCCCTGCCCCTCCCCGCTTCCTGACCTCTGAAGAGGTTGGGAAGTGACCATTTGGATGTCTGGGCCCTGCCAAGGCGACAGGGAGGGTCAGAGGGAGGCCGGCTGCTTCCTGCCCCCACCCTTTCCCCGGGCCTGCTGTGCTGCTTTTGTGCCAAGGTTAGCCAGTCCCCCCTGTTGTGTTCCATGTGCTTTCACCTCTGCCTCATCTTTCCTCCCGTCCCTGCCCCGCCACCTCCCCAAAGAATTGAAACGTCAGCTCAGGATATGGGGCCAATCTCTGTGAGTCCAGCATGTACCTGTCTCTCCCTAGTGTCCCTTCAGCCTGGGCTGACCAGTGCCCGCCTCTGGGCTTGACCAGTTCCCAATCTCGTCCTCTGTCCCCAACTTCTTAAGCACAATTGGGCTTCTTCCATCTCCAGGTTTTCTGCCATTCTTAACCAAGGCTGCCTCTTCCAACAGGGCGGGAATCAGACCTACTCCCCTAGGTCACAACTCTGGGAAGGATACAGAGCCCCCACCCTTCACTGAGTTCTCTGGATTTGTTCTCAGTGCCTTAGCAACGAAAACCTGTGCTTGTGTGTGTGTGGCGGCGGGGAGGGAGGATCCTGTTTCCCACCTCCTTCTCCTCCCCTGTACTCCCCAGTGCCTTCCTTGTTCTGGTGGAGCTGGGGTTTCTCTCCTCCCCAGTCCCACAACACTGCCAAAAATCTGTGTATGTGCCATTGGGTGGGGCAGCCCCAAGCCTCCTGGGGAGGCAGGGCAAAAACAGGTGCCCTCATCGTGGTCTGTGCCATGTCCCGTCTCTATGGTGGTTGAGGAGAAAGGCGGGGAAGCTTCCTCAGCCTTGCAGATATGTGTGGCATTTACTAGCCAGAGCTCTGAAAGGCAGTGCTGTCTGTTTCTTGTACTGGGACCAAAGTAAAAATCCAAGCACATTCCCCTTGCAGTTAGGGGAGGCCCTACTGCCTTCTCAAAGCAGAGAGGCAGCTTATCAAACTCAGCCCAAAACTCTGTTTACATGGGTGGGGAGATGGAGCAGGGAAGTACAGAGTGGGATGGTCAGGACCTGGGCCATTGCAACCAAAATGGGGACTTCCTGGGTAGGGAGGTCACTCCCTCTACTCACTGAGCTAGGATTAGGGAGGGTTATTGCCCCAACCATTGCAATGGGAGGTGGAGGGACAGGCTCAGCCTCCTCATTGTCTAAATGAGGCCTAAATGTGTGAAGTGCGATTTCTGCTTTTGTGTACCCCACCACCCCATTACCACAGCTGCCTTTGTGTGTTTGTGTCAATAAAAAGCCAAACCCTG