Transcript asmbl_74469

Sequence
Transcript Sequence for observation asmbl_74469 of TGE0058697:
CTCCCTTCCCCCCTCCACCGGCCGCGGGCATAAAAGGCGCCAGGTGAGGGCCTCGCCGCTCCTCCCGCGAATCGCAGCTTCTGAGACCAGGGTTGCTCCGTCCGTGCTCCGCCTCGCCATGACTTCCTACAGCTATCGCCAGTCGTCGGCCACGTCGTCCTTCGGAGGCCTGGGCGGCGGCTCCGTGCGTTTTGGGCCGGGGGTCGCCTTTCGCGCGCCCAGCATTCACGGGGGCTCCGGCGGCCGCGGCGTATCCGTGTCCTCCGCCCGCTTTGTGTCCTCGTCCTCCTCGGGGGCCTACGGCGGCGGCTACGGCGGCGTCCTGACCGCGTCCGACGGGCTGCTGGCGGGCAACGAGAAGCTAACCATGCAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGCCCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTACTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCTGGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGGACCGACCTGGAGATGCAGATCGAAGGCCTGAAGGAAGAGCTGGCCTACCTGAAGAAGAACCATGAGGAGGAAATCAGTACGCTGAGGGGCCAAGTGGGAGGCCAGGTCAGTGTGGAGGTGGATTCCGCTCCGGGCACCGATCTCGCCAAGATCCTGAGTGACATGCGAAGCCAATATGAGGTCATGGCCGAGCAGAACCGGAAGGATGCTGAAGCCTGGTTCACCAGCCGGACTGAAGAATTGAACCGGGAGGTCGCTGGCCACACGGAGCAGCTCCAGATGAGCAGGTCCGAGGTTACTGACCTGCGGCGCACCCTTCAGGGTCTTGAGATTGAGCTGCAGTCACAGCTGAGCATGAAAGCTGCCTTGGAAGACACACTGGCAGAAACGGAGGCGCGCTTTGGAGCCCAGCTGGCGCATATCCAGGCGCTGATCAGCGGTATTGAAGCCCAGCTGGGCGATGTGCGAGCTGATAGTGAGCGGCAGAATCAGGAGTACCAGCGGCTCATGGACATCAAGTCGCGGCTGGAGCAGGAGATTGCCACCTACCGCAGCCTGCTCGAGGGACAGGAAGATCACTACAACAATTTGTCTGCCTCCAAGGTCCTCTGAGGCAGCAGGCTCTGGGGCTTCTGCTGTCCTTTGGAGGGTGTCTTCTGGGTAGAGGGATGGGAAGGAAGGGACCCTTACCCCCGGCTCTTCTCCTGACCTGCCAATAAAAATTTATGGTCCAAGGGAG