Transcript asmbl_74284

Sequence
Transcript Sequence for observation asmbl_74284 of TGE0058696:
CGGGCGAGCGAGCGGGCGGCCGGCCGCTGGGGGTGGCGGGATAGGCTGGGCGCGGCCGGCGCTGCAGACCCGCTGCTGTTGTCCGGGTCTGTGCGGTCCCGAGGGCCCTCCGTGCCGCCGGCGCCATGGGCAATTGCCACACGGTGGGGCCCAACGAGGCGCTGGTGGTTTCAGGGGGCTGTTGTGGTTCCGACTATAAACAGTACGTGTTTGGCGGCTGGGCCTGGGCCTGGTGGTGTATCTCCGACACTCAGAGGTGAAGATCATGACGGAGAAGGAACTCCTGGCCGTGGCTTGTGAGCAGTTTCTGGGTAAGAATGTGCAGGACATCAAAAACGTCGTCCTGCAGACCCTGGAGGGACATCTGCGCTCCATCCTCGGGACCCTGACAGTGGAGCAGATTTATCAGGACCGGGACCAGTTTGCCAAGCTGGTGCGGGAGGTGGCAGCCCCTGATGTTGGCCGCATGGGCATTGAGATCCTCAGCTTCACCATCAAGGACGTGTATGACAAAGTGGACTATCTGAGCTCCCTGGGCAAGACGCAGACTGCCGTGGTGCAGAGAGATGCTGACATTGGCGTGGCCGAGGCTGAACGGGACGCAGGCATCCGGGAAGCTGAGTGCAAGAAGGAGATGCTGGATGTGAAGTTCATGGCAGACACCAAGATTGCTGACTCTAAGCGAGCCTTCGAGCTGCAAAAGTCAGCCTTCAGTGAGGAGGTTAACATCAAGACAGCTGAGGCCCAGTTGGCCTATGAGCTGCAGGGGGCCCGTGAACAGCAGAAGATCCGGCAGGAAGAGATTGAGATTGAGGTTGTGCAGCGCAAGAAACAGATTGCCGTGGAGGCACAGGAGATCCTGCGTACGGACAAGGAGCTCATCGCTACAGTGCGCCGGCCTGCCGAGGCCGAGGCCCACCGCATCCAGCAGATTGCCGAGGGTGAAAAGGTGAAGCAGGTCCTCTTGGCACAGGCAGAGGCTGAGAAGATCCGCAAAATCGGGGAGGCGGAAGCGGCAGTCATCGAGGCGATGGGCAAGGCAGAGGCTGAGCGGATGAAGCTCAAGGCAGAAGCCTACCAGAAATACGGGGATGCAGCCAAGATGGCCTTGGTGCTAGAGGCCCTGCCCCAGATTGCTGCCAAAATCGCTGCCCCACTTACCAAGGTCGATGAGATTGTGGTCCTCAGTGGAGACAACAGTAAGGTCACATCAGAAGTGAACCGACTGCTGGCCGAGCTGCCTGCCTCTGTGCATGCCCTCACAGGCGTGGACCTGTCTAAGATACCCCTGATCAAGAAGGCCACTGGTGTGCAGGTGTGAGGCTCCTGCAGGCCCACTCTCTTCAGCAGCCACCCGGCCCTCCCTCCAGCACCCGTTTTAATCCCACAGAACAACGGGAACGTTACTGACTCTGGTGCCTTATCTCGAAGGGACCAGAAGTGCTGCGTGTTCAGGCCATCTCTGGCTGTCTTCCTGTCTCTCCTGTCTGTCCACCTCCTCCTCTTCCTCTCCTTTACCCCACTTTCACTGCCACTTTCATCAGGTTTGTGTCTCATCTCCCTGCGTGTCTTTTCCTTTGTCTGTCTTTTTCTTTCCCCCATGCACATCATGTAGATTAAGCTGAAGATGTTTATTACAATCACTCTCTGTGGGGGGTGGCCCTGCTGCTCCTCAGAATCCTGGTGCCTTGAAGTTCTCTGTGCATCTGTCCATCCTCCCTATGGCCCTGGCCAGAGCTCAGCATGGGCAGGGGTTCTGGGTAGGACGGTCACTGTCCTCTCTCCTGGACTGGTCTTCCCAGCCCTAAACCCTGCCCCAGGAAGCCCACAGCCTCACCTGCTGCTGCCCCTCTAGGTCTGGGCAGCCATGACCTGCAGGGCCCAGAGACACTGTCCTTCCCCTCATCCACCCAAGGCCCCAGCCAGCGCTCATACCCTGTCCTTTCTCCCTGACCCCAAGGGCACAGAGGCAAGGCCTCCTGTCTACAGCAGCTTCCTCAGTTTCCTACTGCCTTAGGAGGCCCCTGCTTGTGCTCAGGGAAGGCCTCTTCATGGGCATGTTCCTGCTGGGGCGGTGCGGTTTGGTCCCAACTCTGCTAAGTTTTCTGAGATGAGGGTCTAGCCCTGTTGGGGACAGAAAAGTGTGTAGACCTTCTTCCTGCTAGGGCTGCACTGTCCTGGGTGTTGGGCCCTTCTGGTGGACAAGGCTGTGCCAACCCTGTACAGAATCGAGTGCTGTAGCCTGGCCAGACCCCAGAGCCCTTGTGCCATCTTTCTTCCTGGCCAGAGTGATGGGGTTCCAGCCATGGGGAAGCAACCCAATCCTCTGTCTCCTTGCTCCAATGGAGGCAGAAGAGCCCAGGACCCAAGCGTCTTGGCAGGGGTGCTGTGAATGTCCAGTGGTCCCAGCTCCCCACCCTGGCCCTGCCCCAGCCTGTGTAGCTCTTCCTGCATGTGGATGCTGCATGTCTGGTCTGGGGCTTGGATGTTGCACTGCCCCACTGCCTGTCCCTTCTGGTAAAATAAAGAACTCTTAATGCCCA