Transcript asmbl_74283

Sequence
Transcript Sequence for observation asmbl_74283 of TGE0000862:
CGGGCGAGCGAGCGGGCGGCCGGCCGCTGGGGGTGGCGGGATAGGCTGGGCGCGGCCGGCGCTGCAGACCCGCTGCTGTTGTCCGGGTCTGTGCGGTCCCGAGGGCCCTCCGTGCCGCCGGCGCCATGGGCAATTGCCACACGGTGGGGCCCAACGAGGCGCTGGTGGTTTCAGGGGGCTGTTGTGGTTCCGACTATAAACAGTACGTGTTTGGCGGCTGGGCCTGGGCCTGGTGGTGTATCTCCGACACTCAGAGGATTTCCCTAGAGATTATGACGTTGCAGCCCCGCTGCGAGGACGTAGAGACGGCCGAGGGGGTAGCTTTAACTGTGACGGGTGTCGCCCAGGTGAAGATCATGACGGAGAAGGAACTCCTGGCCGTGGCTTGTGAGCAGTTTCTGGGTAAGAATGTGCAGGACATCAAAAACGTCGTCCTGCAGACCCTGGAGGGACATCTGCGCTCCATCCTCGGGACCCTGACAGTGGAGCAGATTTATCAGGACCGGGACCAGTTTGCCAAGCTGGTGCGGGAGGTGGCAGCCCCTGATGTTGGCCGCATGGGCATTGAGATCCTCAGCTTCACCATCAAGGACGTGTATGACAAAGTGGACTATCTGAGCTCCCTGGGCAAGACGCAGACTGCCGTGGTGCAGAGAGATGCTGACATTGGCGTGGCCGAGGCTGAACGGGACGCAGGCATCCGGGAAGCTGAGTGCAAGAAGGAGATGCTGGATGTGAAGTTCATGGCAGACACCAAGATTGCTGACTCTAAGCGAGCCTTCGAGCTGCAAAAGTCAGCCTTCAGTGAGGAGGTTAACATCAAGACAGCTGAGGCCCAGTTGGCCTATGAGCTGCAGGGGGCCCGTGAACAGCAGAAGATCCGGCAGGAAGAGATTGAGATTGAGGTTGTGCAGCGCAAGAAACAGATTGCCGTGGAGGCACAGGAGATCCTGCGTACGGACAAGGAGCTCATCGCTACAGTGCGCCGGCCTGCCGAGGCCGAGGCCCACCGCATCCAGCAGATTGCCGAGGGTGAAAAGGTGAAGCAGGTCCTCTTGGCACAGGCAGAGGCTGAGAAGATCCGCAAAATCGGGGAGGCGGAAGCGGCAGTCATCGAGGCGATGGGCAAGGCAGAGGCTGAGCGGATGAAGCTCAAGGCAGAAGCCTACCAGAAATACGGGGATGCAGCCAAGATGGCCTTGGTGCTAGAGGCCCTGCCCCAGATTGCTGCCAAAATCGCTGCCCCACTTACCAAGGTCGATGAGATTGTGGTCCTCAGTGGAGACAACAGTAAGGTCACATCAGAAGTGAACCGACTGCTGGCCGAGCTGCCTGCCTCTGTGCATGCCCTCACAGGCGTGGACCTGTCTAAGATACCCCTGATCAAGAAGGCCACTGGTGTGCAGGTGTGAGGCTCCTGCAGGCCCACTCTCTTCAGCAGCCACCCGGCCCTCCCTCCAGCACCCGTTTTAATCCCACAGAACAACGGGAACGTTACTGACTCTGGTGCCTTATCTCGAAGGGACCAGAAGTGCTGCGTGTTCAGGCCATCTCTGGCTGTCTTCCTGTCTCTCCTGTCTGTCCACCTCCTCCTCTTCCTCTCCTTTACCCCACTTTCACTGCCACTTTCATCAGGTTTGTGTCTCATCTCCCTGCGTGTCTTTTCCTTTGTCTGTCTTTTTCTTTCCCCCATGCACATCATGTAGATTAAGCTGAAGATGTTTATTACAATCACTCTCTGTGGGGGGTGGCCCTGCTGCTCCTCAGAATCCTGGTGCCTTGAAGTTCTCTGTGCATCTGTCCATCCTCCCTATGGCCCTGGCCAGAGCTCAGCATGGGCAGGGGTTCTGGGTAGGACGGTCACTGTCCTCTCTCCTGGACTGGTCTTCCCAGCCCTAAACCCTGCCCCAGGAAGCCCACAGCCTCACCTGCTGCTGCCCCTCTAGGTCTGGGCAGCCATGACCTGCAGGGCCCAGAGACACTGTCCTTCCCCTCATCCACCCAAGGCCCCAGCCAGCGCTCATACCCTGTCCTTTCTCCCTGACCCCAAGGGCACAGAGGCAAGGCCTCCTGTCTACAGCAGCTTCCTCAGTTTCCTACTGCCTTAGGAGGCCCCTGCTTGTGCTCAGGGAAGGCCTCTTCATGGGCATGTTCCTGCTGGGGCGGTGCGGTTTGGTCCCAACTCTGCTAAGTTTTCTGAGATGAGGGTCTAGCCCTGTTGGGGACAGAAAAGTGTGTAGACCTTCTTCCTGCTAGGGCTGCACTGTCCTGGGTGTTGGGCCCTTCTGGTGGACAAGGCTGTGCCAACCCTGTACAGAATCGAGTGCTGTAGCCTGGCCAGACCCCAGAGCCCTTGTGCCATCTTTCTTCCTGGCCAGAGTGATGGGGTTCCAGCCATGGGGAAGCAACCCAATCCTCTGTCTCCTTGCTCCAATGGAGGCAGAAGAGCCCAGGACCCAAGCGTCTTGGCAGGGGTGCTGTGAATGTCCAGTGGTCCCAGCTCCCCACCCTGGCCCTGCCCCAGCCTGTGTAGCTCTTCCTGCATGTGGATGCTGCATGTCTGGTCTGGGGCTTGGATGTTGCACTGCCCCACTGCCTGTCCCTTCTGGTAAAATAAAGAACTCTTAATGCCCA