Transcript asmbl_74256

Sequence
Transcript Sequence for observation asmbl_74256 of TGE0058695:
CACGTAGCTCTGCGACATCCGCAGCCTCATTTACCAGAGGGAGCCAGGGCTGCAGCCTCATCTGTTTGCGGATCAGAACCCGAGCTGTGCTTGTGGCTGCGGCTGCTAACTGGCTGCGCACAGGGAGCTGTCACCATGCCTCACTCGTACCCAGCCCTTTCTGCTGAGCAGAAGAAGGAGTTGTCTGACATTGCCCTGCGGATTGTAGCCCCGGGCAAAGGCATTCTGGCTGCGGATGAGTCTGTAGGCAGCATGGCCAAGCGGCTGAGCCAAATTGGGGTGGAAAACACAGAGGAGAACCGCCGGCTGTACCGCCAGGTCCTGTTCAGTGCTGATGACCGTGTGAAAAAGTGCATTGGAGGCGTCATTTTCTTCCATGAGACCCTCTACCAGAAAGATGATAATGGTGTTCCCTTCGTCCGAACCATCCAGGATAAGGGCATCGTCGTGGGCATCAAGGTTGACAAGGGTGTGGTGCCTCTAGCTGGGACTGATGGAGAAACCACCACTCAAGGGCTGGATGGGCTCTCAGAACGCTGTGCCCAATACAAGAAGGATGGTGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAAATCAGTGAGCGTACACCCTCTGCACTTGCCATTCTGGAGAACGCCAACGTGCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCTATTGTGGAACCTGAAATATTGCCTGATGGAGACCACGACCTCAAACGTTGTCAGTATGTTACAGAGAAGGTCTTGGCTGCTGTGTACAAGGCCCTGAGTGACCATCATGTATACCTGGAGGGGACCCTGCTCAAGCCCAACATGGTGACCCCGGGCCATGCCTGTCCCATCAAGTATACCCCAGAGGAGATTGCCATGGCAACTGTCACTGCCCTGCGTCGCACTGTGCCCCCAGCTGTCCCAGGAGTGACCTTCCTGTCTGGGGGTCAGAGCGAAGAAGAGGCATCATTCAACCTCAATGCCATCAACCGCTGCCCCCTTCCCCGACCCTGGGCGCTTACCTTCTCCTATGGGCGTGCCCTGCAAGCCTCTGCACTCAATGCCTGGCGAGGGCAACGGGACAATGCTGGGGCTGCCACTGAGGAGTTCATCAAGCGGGCTGAGGTGAATGGGCTTGCAGCCCAGGGCAAGTATGAAGGCAGTGGAGAAGATGGTGGAGCAGCAGCACAGTCACTCTACATTGCCAACCATGCCTACTGAGTATCCACTCCATACCACAGCCCTTGGCCCAGCCATCTGCACCCACTTTTGCTTGTAGTCATGGCCAGGGCCAAATAGCTATGCAGAGCAGAGATGCCTTCACCTGGCACCAACTTGTCTTCCTTTCTCTCTTCCCTTCCCCTCTCTCATTGCTGCACCTGGGACCATAGGATGGGAGGATAGGGAGCCCCTCATGACTGAGGGCAGAAGAAATTGCTAGAAGTCAGAACAGGATGGCTGGGTCTCCCCCTACCTCTTCCAGCTCCCACAATTTTCCCATGATGAGGTAGCTTCTCCCTGGGCTCTCCTTCTTGCCTGCCCTGTCTCCTGGGATCAGAGGGTAGTACAGAAGCCCTGACTCATGCCTTGAGTACATACCATACAGCAAATAAATGGTAGCAAAAC