Transcript asmbl_74245

Sequence
Transcript Sequence for observation asmbl_74245 of TGE0058694:
GTCTCTGCCTCTCCCTCCCTTCCTCAGGCATCAGAGCGGAGACTTCAGGGAGACCAGAGCCCAGCTTGCCAGGCACTGAGCTAGAAGCCCTGCCATGGCACCCCTGAGACCCCTTCTCATACTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGAGTCATGCAAGGGCCGCTGCACTGAGGGCTTCAACGTGGACAAGAAGTGCCAGTGTGACGAGCTCTGCTCTTACTACCAGAGCTGCTGCACAGACTATACGGCTGAGTGCAAGCCCCAAGTGACTCGCGGGGATGTGTTCACTATGCCGGAGGATGAGTACACGGTCTATGACGATGGCGAGGAGAAAAACAATGCCACTGTCCATGAACAGGTGGGGGGCCCCTCCCTGACCTCTGACCTCCAGGCCCAGTCCAAAGGGAATCCTGAGCAGACACCTGTTCTGAAACCTGAGGAAGAGGCCCCTGCGCCTGAGGTGGGCGCCTCTAAGCCTGAGGGGATAGACTCAAGGCCTGAGACCCTTCATCCAGGGAGACCTCAGCCCCCAGCAGAGGAGGAGCTGTGCAGTGGGAAGCCCTTCGACGCCTTCACCGACCTCAAGAACGGTTCCCTCTTTGCCTTCCGAGGGCAGTACTGCTATGAACTGGACGAAAAGGCAGTGAGGCCTGGGTACCCCAAGCTCATCCGAGATGTCTGGGGCATCGAGGGCCCCATCGATGCCGCCTTCACCCGCATCAACTGTCAGGGGAAGACCTACCTCTTCAAGGGTAGTCAGTACTGGCGCTTTGAGGATGGTGTCCTGGACCCTGATTACCCCCGAAATATCTCTGACGGCTTCGATGGCATCCCGGACAACGTGGATGCAGCCTTGGCCCTCCCTGCCCATAGCTACAGTGGCCGGGAGCGGGTCTACTTCTTCAAGGGGAAACAGTACTGGGAGTACCAGTTCCAGCACCAGCCCAGTCAGGAGGAGTGTGAAGGCAGCTCCCTGTCGGCTGTGTTTGAACACTTTGCCATGATGCAGCGGGACAGCTGGGAGGACATCTTCGAGCTTCTCTTCTGGGGCAGAACCTCTGCTGGTACCAGACAGCCCCAGTTCATTAGCCGGGACTGGCACGGTGTGCCAGGGCAAGTGGACGCAGCCATGGCTGGCCGCATCTACATCTCAGGCATGGCACCCCGCCCCTCCTTGGCCAAGAAACAAAGGTTTAGGCATCGCAACCGCAAAGGCTACCGTTCACAACGAGGCCACAGCCGTGGCCGCAACCAGAACTCCCGCCGGCCATCCCGCGCCACGTGGCTGTCCTTGTTCTCCAGTGAGGAGAGCAACTTGGGAGCCAACAACTATGATGAC