Transcript asmbl_74088

Sequence
Transcript Sequence for observation asmbl_74088 of TGE0056568:
CCCCGAGCAGCAGTGCTAAAGGAGCCCGGCGGAGGCAGCGGTGGGTTTGGGACTGAGGCGCTGGATCTGTGGTCGCGGCTGGGGACGTGCGCCCGCGCCACCATCTTCGGCTGAAGAGGCAATTGCTTTTGGATCGTTCCATTTACAATGGCGCAGAGAACTGGACTCGAGGATCCAGAGAGGTATCTCTTTGTGGACAGGGCTGTCATCTACAACCCTGCCACTCAAGCTGATTGGACAGCTAAAAAGCTAGTGTGGATTCCATCAGAACGCCATGGTTTTGAGGCAGCTAGTATCAAAGAAGAACGGGGAGATGAAGTTATGGTGGAGTTGGCAGAGAATGGAAAGAAAGCAATGGTCAACAAAGATGATATTCAGAAGATGAACCCACCTAAGTTTTCCAAGGTGGAGGATATGGCAGAATTGACATGCTTGAATGAAGCTTCCGTTTTACATAATCTGAAGGATCGCTACTATTCAGGACTAATCTATACTTATTCTGGACTCTTCTGTGTAGTTATAAACCCTTACAAGAATCTTCCAATTTACTCTGAGAATATTATTGAAATGTACAGAGGGAAGAAGCGTCATGAGATGCCTCCACACATCTATGCTATATCTGAATCTGCTTACAGATGCATGCTTCAAGATCGTGAGGACCAGTCAATTCTTTGCACGGGTGAGTCAGGTGCTGGGAAGACAGAAAATACAAAGAAAGTTATTCAGTACCTTGCCCATGTTGCTTCTTCACATAAAGGAAGAAAGGACCATAATATTCCTGGGGAACTTGAACGGCAGCTTTTGCAAGCAAATCCAATTCTGGAATCATTTGGAAATGCGAAGACTGTGAAAAATGATAACTCATCTCGTTTTGGCAAATTTATTCGGATCAACTTTGATGTAACTGGCTATATCGTTGGGGCCAACATTGAAACATACCTTCTGGAAAAGTCTCGTGCTGTTCGTCAAGCAAAAGATGAACGTACTTTTCATATCTTTTACCAGTTGTTATCTGGAGCAGGAGAACACCTAAAGTCTGATTTGCTTCTTGAAGGATTTAATAACTACAGGTTTCTCTCCAATGGCTATATTCCTATTCCGGGACAGCAAGACAAAGATAATTTCCAGGAGACCATGGAAGCAATGCACATAATGGGCTTCTCCCATGAAGAGATTCTGTCAATGCTTAAAGTAGTATCTTCAGTGCTACAGTTTGGAAATATTTCTTTCAAAAAGGAGAGAAATACTGATCAAGCTTCCATGCCAGAAAATACAGTTGCGCAGAAGCTCTGCCATCTTCTTGGGATGAATGTGATGGAGTTTACTCGGGCCATCCTGACTCCCCGGATCAAGGTCGGCCGAGACTATGTGCAAAAAGCCCAGACCAAAGAACAGGCAGATTTTGCAGTAGAAGCATTGGCAAAAGCTACCTATGAGCGGCTCTTTCGCTGGCTCGTTCATCGCATCAATAAAGCTCTGGATAGGACCAAACGTCAGGGAGCATCTTTCATTGGAATCCTGGATATTGCTGGATTTGAAATTTTTGAGCTGAACTCCTTTGAACAACTTTGCATCAACTACACCAATGAGAAGCTGCAGCAGCTGTTCAACCACACCATGTTTATCCTAGAACAAGAGGAATACCAGCGCGAAGGCATCGAGTGGAACTTCATCGATTTCGGGCTGGATCTGCAGCCATGCATCGACCTAATAGAGAGACCTGCGAACCCTCCTGGTGTACTGGCCCTTTTGGATGAAGAATGCTGGTTCCCTAAAGCCACAGATAAAACCTTTGTTGAAAAACTGGTTCAAGAGCAAGGTTCCCACTCCAAGTTTCAGAAACCTCGACAATTAAAAGACAAAGCTGATTTTTGCATTATACATTATGCAGGGAAGGTGGACTATAAGGCAGATGAGTGGCTGATGAAGAATATGGACCCCCTGAATGACAACGTGGCCACCCTTTTGCACCAGTCATCAGACAGATTTGTGGCAGAGCTTTGGAAAGATGTGGACCGTATCGTGGGTCTGGATCAAGTCACTGGTATGACTGAGACAGCTTTTGGCTCCGCATATAAAACCAAGAAGGGCATGTTTCGTACCGTTGGGCAACTCTACAAAGAATCTCTCACCAAGCTGATGGCAACTCTCCGAAACACCAACCCTAACTTTGTTCGTTGTATCATTCCAAATCACGAGAAGAGGGCTGGAAAATTGGATCCACACCTAGTCCTAGATCAGCTTCGCTGTAACGGTGTCCTGGAAGGGATCCGAATCTGTCGCCAGGGCTTCCCTAACCGAATAGTTTTCCAGGAATTCAGACAGAGATATGAGATCCTAACTCCAAATGCTATTCCTAAAGGTTTTATGGATGGTAAACAGGCCTGTGAACGAATGATCCGGGCTTTAGAATTGGACCCAAACTTGTACAGAATTGGACAGAGCAAGATATTTTTCAGAGCTGGAGTTCTGGCACACTTAGAGGAAGAAAGAGATTTAAAAATCACCGATATCATTATCTTCTTCCAGGCCGTTTGCAGAGGTTACCTGGCCAGAAAGGCCTTTGCCAAGAAGCAGCAGCAACTAAGTGCCTTAAAGGTCTTGCAGCGGAACTGTGCCGCGTACCTGAAATTACGGCACTGGCAGTGGTGGCGAGTCTTCACAAAGGTGAAGCCGCTTCTACAAGTGACTCGCCAGGAGGAAGAACTTCAGGCCAAAGATGAAGAGCTGTTGAAGGTGAAGGAGAAGCAGACGAAGGTGGAAGGAGAGCTGGAGGAGATGGAGCGGAAGCACCAGCAGCTTTTAGAAGAGAAGAATATCCTTGCAGAACAACTACAAGCAGAGACTGAGCTCTTTGCTGAAGCAGAAGAGATGAGGGCAAGACTTGCTGCTAAAAAGCAGGAATTAGAAGAGATTCTACATGACTTGGAGTCTAGGGTTGAAGAAGAAGAAGAAAGAAACCAAATCCTCCAAAATGAAAAGAAAAAAATGCAAGCACATATTCAGGACCTGGAAGAACAGCTAGACGAGGAGGAAGGGGCTCGGCAAAAGCTGCAGCTGGAAAAGGTGACAGCAGAGGCCAAGATCAAGAAGATGGAAGAGGAGATTCTGCTTCTCGAGGACCAAAATTCCAAGTTCATCAAAGAAAAGAAACTCATGGAAGATCGCATTGCTGAGTGTTCCTCTCAGCTGGCTGAAGAGGAAGAAAAGGCGAAAAACTTGGCCAAAATCAGGAATAAGCAAGAAGTGATGATCTCAGATTTAGAAGAACGCTTAAAGAAGGAAGAAAAGACTCGTCAGGAACTGGAAAAGGCCAAAAGAAAACTCGACGGGGAGACGACCGACCTGCAGGACCAGATCGCAGAGCTGCAGGCGCAGATTGATGAGCTCAAGCTGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGGCGCACTGGCCAGAGGTGATGATGAAACACTCCATAAGAACAATGCCCTTAAAGTTGTGCGAGAGCTACAAGCCCAAATTGCTGAACTTCAGGAAGACTTTGAATCCGAGAAGGCTTCACGGAACAAGGCCGAAAAGCAGAAAAGGGACTTGAGTGAGGAACTGGAAGCTCTGAAAACAGAGCTGGAGGACACGCTGGACACCACGGCAGCCCAGCAGGAACTACGTACAAAACGTGAACAAGAAGTGGCAGAGCTGAAGAAAGCTCTTGAGGAGGAAACTAAGAACCATGAAGCTCAAATCCAGGACATGAGACAAAGACACGCAACAGCCCTGGAGGAGCTCTCAGAGCAGCTGGAACAGGCCAAGCGGTTCAAAGCAAATCTAGAGAAGAACAAGCAGGGCCTGGAGACAGATAACAAGGAGCTGGCGTGTGAGGTGAAGGTCCTGCAGCAGGTCAAGGCTGAGTCTGAGCACAAGAGGAAGAAGCTCGACGCGCAGGTCCAGGAGCTCCATGCCAAGGTCTCTGAAGGCGACAGGCTCAGGGTGGAGCTGGCGGAGAAAGCAAGTAAGCTGCAGAATGAGCTAGATAATGTCTCCACCCTTCTGGAAGAAGCAGAGAAGAAGGGTATTAAATTTGCTAAGGATGCAGCTAGTCTTGAGTCTCAACTACAGGATACACAGGAGCTTCTTCAGGAGGAGACACGCCAGAAACTAAACCTGAGCAGTCGGATCCGGCAGCTGGAAGAGGAGAAGAACAGTCTTCAGGAGCAGCAGGAGGAGGAGGAGGAGGCCAGGAAGAACCTGGAGAAGCAAGTGCTGGCCCTGCAGTCCCAGTTGGCTGATACCAAGAAGAAAGTAGATGACGACCTGGGAACAATTGAAAGTCTGGAAGAAGCCAAGAAGAAGCTTCTGAAGGACGCGGAGGCCCTGAGCCAGCGCCTGGAGGAGAAGGCACTGGCGTATGACAAACTGGAGAAGACCAAGAACCGCCTGCAGCAGGAGCTGGACGACCTCACGGTGGACCTGGACCACCAGCGCCAGGTCGCCTCCAACTTGGAGAAGAAGCAGAAGAAGTTTGACCAGCTGTTAGCAGAAGAGAAGAGCATCTCTGCTCGCTATGCCGAAGAGCGGGACCGGGCCGAAGCCGAGGCCAGAGAGAAAGAAACCAAAGCCCTGTCACTGGCCCGGGCCCTCGAGGAAGCCCTGGAGGCCAAGGAGGAGTTTGAGAGGCAGAACAAGCAGCTCCGAGCAGACATGGAAGACCTCATGAGCTCCAAAGATGATGTGGGAAAAAACGTTCACGAACTTGAAAAATCCAAACGGGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAAGCCGAGCTGGTGGAAGGCCCCTCCCCATCGCCAGCCGGGCCCTCATGCTGACCTTGCAAATTCAGCCGCTGCTTTGAGCCCAAAATGGGAATATTGGTTTTGTGTCCGAGGCTTGTTCCAAGTTTGTCAATGAGGTTTATGGAGCCTCCAGAACAGATGCCATCTTCCTGAATGTTGACATGCCAGTGGGTGTGACTCCTTCATTTTTCCTTCTCCCTTCCCTTTGGACAGTGTTACAGTGAACACTTAGCATCCTGTTTTTGGTTGGTAGTTAAGCAAACTGACATTACGGAAAGTGCCTTAGACACTACAGTACTAAGACAATGTTGAATATATCATTCGCCTCTATAACAATTTAATGTATTCAGTTTTGACTGTGCTTCATATCATGTACCTCTCTAGTCAAAGTGGTATTACAGACATTCAGTGACAATGAATCAGTGTTAATTCTAAATCCTTGATCCTCTGCAATGTGCTTGAAAACACAAACCTTTTGGGTTAAAAGCTTTAACATCTATTAGGAAGAATTTGTCCTGTGGGTTTGGAATCTTGGATTTTCCCCCTTTATGAACTGTACTGGCTGTTGACCACCAGACACCTGACCGCAAATATCTTTTCTTGTATTCCCATATTTCTAGACAATGATTTTTGTAAGACAATAAATTTATTCATTATAGATATTTGCGCCTGCTCTGTTTACTTGAAGAAAAAAGCACCCGTGGAGAATAAAGAGACCTCAATAAACAAGAATAATCATG