Transcript asmbl_74087

Sequence
Transcript Sequence for observation asmbl_74087 of TGE0056568:
CCCCGAGCAGCAGTGCTAAAGGAGCCCGGCGGAGGCAGCGGTGGGTTTGGGACTGAGGCGCTGGATCTGTGGTCGCGGCTGGGGACGTGCGCCCGCGCCACCATCTTCGGCTGAAGTAACTGAGGGCAAACCCATCAGACAACCAGAGCCATAATTTGTGGTCACCGCTGAAATTTACCTTGGAAACTCGAGGCAATTGCTTTTGGATCGTTCCATTTACAATGGCGCAGAGAACTGGACTCGAGGATCCAGAGAGGTATCTCTTTGTGGACAGGGCTGTCATCTACAACCCTGCCACTCAAGCTGATTGGACAGCTAAAAAGCTAGTGTGGATTCCATCAGAACGCCATGGTTTTGAGGCAGCTAGTATCAAAGAAGAACGGGGAGATGAAGTTATGGTGGAGTTGGCAGAGAATGGAAAGAAAGCAATGGTCAACAAAGATGATATTCAGAAGATGAACCCACCTAAGTTTTCCAAGGTGGAGGATATGGCAGAATTGACATGCTTGAATGAAGCTTCCGTTTTACATAATCTGAAGGATCGCTACTATTCAGGACTAATCTATACTTATTCTGGACTCTTCTGTGTAGTTATAAACCCTTACAAGAATCTTCCAATTTACTCTGAGAATATTATTGAAATGTACAGAGGGAAGAAGCGTCATGAGATGCCTCCACACATCTATGCTATATCTGAATCTGCTTACAGATGCATGCTTCAAGATCGTGAGGACCAGTCAATTCTTTGCACGGGTGAGTCAGGTGCTGGGAAGACAGAAAATACAAAGAAAGTTATTCAGTACCTTGCCCATGTTGCTTCTTCACATAAAGGAAGAAAGGACCATAATATTCCTGGGGAACTTGAACGGCAGCTTTTGCAAGCAAATCCAATTCTGGAATCATTTGGAAATGCGAAGACTGTGAAAAATGATAACTCATCTCGTTTTGGCAAATTTATTCGGATCAACTTTGATGTAACTGGCTATATCGTTGGGGCCAACATTGAAACATACCTTCTGGAAAAGTCTCGTGCTGTTCGTCAAGCAAAAGATGAACGTACTTTTCATATCTTTTACCAGTTGTTATCTGGAGCAGGAGAACACCTAAAGTCTGATTTGCTTCTTGAAGGATTTAATAACTACAGGTTTCTCTCCAATGGCTATATTCCTATTCCGGGACAGCAAGACAAAGATAATTTCCAGGAGACCATGGAAGCAATGCACATAATGGGCTTCTCCCATGAAGAGATTCTGTCAATGCTTAAAGTAGTATCTTCAGTGCTACAGTTTGGAAATATTTCTTTCAAAAAGGAGAGAAATACTGATCAAGCTTCCATGCCAGAAAATACAGTTGCGCAGAAGCTCTGCCATCTTCTTGGGATGAATGTGATGGAGTTTACTCGGGCCATCCTGACTCCCCGGATCAAGGTCGGCCGAGACTATGTGCAAAAAGCCCAGACCAAAGAACAGGCAGATTTTGCAGTAGAAGCATTGGCAAAAGCTACCTATGAGCGGCTCTTTCGCTGGCTCGTTCATCGCATCAATAAAGCTCTGGATAGGACCAAACGTCAGGGAGCATCTTTCATTGGAATCCTGGATATTGCTGGATTTGAAATTTTTGAGCTGAACTCCTTTGAACAACTTTGCATCAACTACACCAATGAGAAGCTGCAGCAGCTGTTCAACCACACCATGTTTATCCTAGAACAAGAGGAATACCAGCGCGAAGGCATCGAGTGGAACTTCATCGATTTCGGGCTGGATCTGCAGCCATGCATCGACCTAATAGAGAGACCTGCGAACCCTCCTGGTGTACTGGCCCTTTTGGATGAAGAATGCTGGTTCCCTAAAGCCACAGATAAAACCTTTGTTGAAAAACTGGTTCAAGAGCAAGGTTCCCACTCCAAGTTTCAGAAACCTCGACAATTAAAAGACAAAGCTGATTTTTGCATTATACATTATGCAGGGAAGGTGGACTATAAGGCAGATGAGTGGCTGATGAAGAATATGGACCCCCTGAATGACAACGTGGCCACCCTTTTGCACCAGTCATCAGACAGATTTGTGGCAGAGCTTTGGAAAGATGTGGACCGTATCGTGGGTCTGGATCAAGTCACTGGTATGACTGAGACAGCTTTTGGCTCCGCATATAAAACCAAGAAGGGCATGTTTCGTACCGTTGGGCAACTCTACAAAGAATCTCTCACCAAGCTGATGGCAACTCTCCGAAACACCAACCCTAACTTTGTTCGTTGTATCATTCCAAATCACGAGAAGAGGGCTGGAAAATTGGATCCACACCTAGTCCTAGATCAGCTTCGCTGTAACGGTGTCCTGGAAGGGATCCGAATCTGTCGCCAGGGCTTCCCTAACCGAATAGTTTTCCAGGAATTCAGACAGAGATATGAGATCCTAACTCCAAATGCTATTCCTAAAGGTTTTATGGATGGTAAACAGGCCTGTGAACGAATGATCCGGGCTTTAGAATTGGACCCAAACTTGTACAGAATTGGACAGAGCAAGATATTTTTCAGAGCTGGAGTTCTGGCACACTTAGAGGAAGAAAGAGATTTAAAAATCACCGATATCATTATCTTCTTCCAGGCCGTTTGCAGAGGTTACCTGGCCAGAAAGGCCTTTGCCAAGAAGCAGCAGCAACTAAGTGCCTTAAAGGTCTTGCAGCGGAACTGTGCCGCGTACCTGAAATTACGGCACTGGCAGTGGTGGCGAGTCTTCACAAAGGTGAAGCCGCTTCTACAAGTGACTCGCCAGGAGGAAGAACTTCAGGCCAAAGATGAAGAGCTGTTGAAGGTGAAGGAGAAGCAGACGAAGGTGGAAGGAGAGCTGGAGGAGATGGAGCGGAAGCACCAGCAGCTTTTAGAAGAGAAGAATATCCTTGCAGAACAACTACAAGCAGAGACTGAGCTCTTTGCTGAAGCAGAAGAGATGAGGGCAAGACTTGCTGCTAAAAAGCAGGAATTAGAAGAGATTCTACATGACTTGGAGTCTAGGGTTGAAGAAGAAGAAGAAAGAAACCAAATCCTCCAAAATGAAAAGAAAAAAATGCAAGCACATATTCAGGACCTGGAAGAACAGCTAGACGAGGAGGAAGGGGCTCGGCAAAAGCTGCAGCTGGAAAAGGTGACAGCAGAGGCCAAGATCAAGAAGATGGAAGAGGAGATTCTGCTTCTCGAGGACCAAAATTCCAAGTTCATCAAAGAAAAGAAACTCATGGAAGATCGCATTGCTGAGTGTTCCTCTCAGCTGGCTGAAGAGGAAGAAAAGGCGAAAAACTTGGCCAAAATCAGGAATAAGCAAGAAGTGATGATCTCAGATTTAGAAGAACGCTTAAAGAAGGAAGAAAAGACTCGTCAGGAACTGGAAAAGGCCAAAAGAAAACTCGACGGGGAGACGACCGACCTGCAGGACCAGATCGCAGAGCTGCAGGCGCAGATTGATGAGCTCAAGCTGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGGCGCACTGGCCAGAGGTGATGATGAAACACTCCATAAGAACAATGCCCTTAAAGTTGTGCGAGAGCTACAAGCCCAAATTGCTGAACTTCAGGAAGACTTTGAATCCGAGAAGGCTTCACGGAACAAGGCCGAAAAGCAGAAAAGGGACTTGAGTGAGGAACTGGAAGCTCTGAAAACAGAGCTGGAGGACACGCTGGACACCACGGCAGCCCAGCAGGAACTACGTACAAAACGTGAACAAGAAGTGGCAGAGCTGAAGAAAGCTCTTGAGGAGGAAACTAAGAACCATGAAGCTCAAATCCAGGACATGAGACAAAGACACGCAACAGCCCTGGAGGAGCTCTCAGAGCAGCTGGAACAGGCCAAGCGGTTCAAAGCAAATCTAGAGAAGAACAAGCAGGGCCTGGAGACAGATAACAAGGAGCTGGCGTGTGAGGTGAAGGTCCTGCAGCAGGTCAAGGCTGAGTCTGAGCACAAGAGGAAGAAGCTCGACGCGCAGGTCCAGGAGCTCCATGCCAAGGTCTCTGAAGGCGACAGGCTCAGGGTGGAGCTGGCGGAGAAAGCAAGTAAGCTGCAGAATGAGCTAGATAATGTCTCCACCCTTCTGGAAGAAGCAGAGAAGAAGGGTATTAAATTTGCTAAGGATGCAGCTAGTCTTGAGTCTCAACTACAGGATACACAGGAGCTTCTTCAGGAGGAGACACGCCAGAAACTAAACCTGAGCAGTCGGATCCGGCAGCTGGAAGAGGAGAAGAACAGTCTTCAGGAGCAGCAGGAGGAGGAGGAGGAGGCCAGGAAGAACCTGGAGAAGCAAGTGCTGGCCCTGCAGTCCCAGTTGGCTGATACCAAGAAGAAAGTAGATGACGACCTGGGAACAATTGAAAGTCTGGAAGAAGCCAAGAAGAAGCTTCTGAAGGACGCGGAGGCCCTGAGCCAGCGCCTGGAGGAGAAGGCACTGGCGTATGACAAACTGGAGAAGACCAAGAACCGCCTGCAGCAGGAGCTGGACGACCTCACGGTGGACCTGGACCACCAGCGCCAGGTCGCCTCCAACTTGGAGAAGAAGCAGAAGAAGTTTGACCAGCTGTTAGCAGAAGAGAAGAGCATCTCTGCTCGCTATGCCGAAGAGCGGGACCGGGCCGAAGCCGAGGCCAGAGAGAAAGAAACCAAAGCCCTGTCACTGGCCCGGGCCCTCGAGGAAGCCCTGGAGGCCAAGGAGGAGTTTGAGAGGCAGAACAAGCAGCTCCGAGCAGACATGGAAGACCTCATGAGCTCCAAAGATGATGTGGGAAAAAACGTTCACGAACTTGAAAAATCCAAACGGGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAAGCCGAGCTGGTGGAAGGCCCCTCCCCATCGCCAGCCGGGCCCTCATGCTGACCTTGCAAATTCAGCCGCTGCTTTGAGCCCAAAATGGGAATATTGGTTTTGTGTCCGAGGCTTGTTCCAAGTTTGTCAATGAGGTTTATGGAGCCTCCAGAACAGATGCCATCTTCCTGAATGTTGACATGCCAGTGGGTGTGACTCCTTCATTTTTCCTTCTCCCTTCCCTTTGGACAGTGTTACAGTGAACACTTAGCATCCTGTTTTTGGTTGGTAGTTAAGCAAACTGACATTACGGAAAGTGCCTTAGACACTACAGTACTAAGACAATGTTGAATATATCATTCGCCTCTATAACAATTTAATGTATTCAGTTTTGACTGTGCTTCATATCATGTACCTCTCTAGTCAAAGTGGTATTACAGACATTCAGTGACAATGAATCAGTGTTAATTCTAAATCCTTGATCCTCTGCAATGTGCTTGAAAACACAAACCTTTTGGGTTAAAAGCTTTAACATCTATTAGGAAGAATTTGTCCTGTGGGTTTGGAATCTTGGATTTTCCCCCTTTATGAACTGTACTGGCTGTTGACCACCAGACACCTGACCGCAAATATCTTTTCTTGTATTCCCATATTTCTAGACAATGATTTTTGTAAGACAATAAATTTATTCATTATAGATATTTGCGCCTGCTCTGTTTACTTGAAGAAAAAAGCACCCGTGGAGAATAAAGAGACCTCAATAAACAAGAATAATCATG