Transcript asmbl_73806

Sequence
Transcript Sequence for observation asmbl_73806 of TGE0058692:
GAGCCCTCCAGAGGGGCCGGGTACTCCGCGCGCTCGGCCAGGGCACCCGTTGGCCGTCCCTGTCCCTGGGGCGCGAGCTCCGTGCTGACGAGGAAAACCAAGATCTTCCTGGGTTCGAGGCTCGGACCAGGCCCCGGCGCGTGTGGGTGGACGGCGTCCCGCACGGAGAACGCTCCGCCCGCCGGGCGCGCCGGCCGTATTTGGACATTGGTTCTATTTTTAACTTTCCCGGGACTCGAGTTCGGGGGTTGGGGGAGGAAAATCCCGCTTCCTCTGGGACCCGCAGGCCTCGGTGCCCGCCCAGCGCCCAGGCCCGCCGCGGAGTGTAGTCCCAGGCCCGGAAGTGAGTTCCGGGTCGGTGTAGACGCGGCGGCCGCGCGGGTTCCGGGCTCCACCCTGGTGCCAACGGCGTCCCTCCTGGAAAACCTGACTCAGGCGGAGCCCGCCCCCGCCCCCGGCCCGCGGACCCCCCGCCCCGACACCCCCACCTCCACCAACCCCACCTGGAGGGGACCCCAGCCCGGCCGCGCGGGAGGCGGGGGAGGCCGGGGAAGCCCCGCGCTTCAGGGGCCCGGGTGGGGGCGGTGCGGGGGGCGGGCCCTCCCTCGCTGACGCCGCCGCCACCGCCGCCGAGCCCGGGACCCGGAGCGCGGGCAGCGGAGCGGGCGCCAGGCCGGCCGGGCAGGATGCGCTACCGGGCGTCGGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTT