Transcript asmbl_73805

Sequence
Transcript Sequence for observation asmbl_73805 of TGE0056565:
AGCCCCCTGTCCGGGCCCTGCATGACCAGGCCCCAGCAGCCCTGGTCTCTCAAACTCATGCCCCTCCTCTTCCTGCTCCAACCATCCGGGCCAAGAGGCCTCCCAGTCAGACCTGGACGGCTCCAGCCGTGTCCTGAGGAGCTGGACCAGCCACATCCCCTGGGGCTGCAGTTGAAGCAGAACCAAGTGGCCATCCCGGCGTTAGACCGTAGGTTCCTGGTCCCGGAGTGGTCGGAGCCCGCCAGTGGGCAGGCAGCTCTTGCTCACAGGCCGCGGTGCCCAGGCCGCTGGCTCTCCGCAGGGCGGAATGGCGCTGCAAGTGGAGCTGGTACCCACCGGGGAGATCATCCGCGTGGTTCATCCCCACAGGCCCTGCAAGCTTGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTT