Transcript asmbl_73804

Sequence
Transcript Sequence for observation asmbl_73804 of TGE0056566:
CCGAAAGCGCTGGGATTACAGGCGTGAGCCACCGCGCCCGGCCCTCCCTCTAGATTTTAAACCTGGGGGCACCGCAGCGGGCGTCTCCTCCCGCCCTCCCCCGCCTCTGTCCGAGACGCCGCCATTCCCCCTCCCCCGCTCCCACTCCCCCACCAGCTGGTGCCCCCGCTCGGGGGTCCCCAGGGCCGCCGCTCCGGCCGGGTTGTTGCAGTGACGAGCCTTCCCCGCAAGGATCCGGCCCGCACCTGCCGCAGCCTCGCCCTCTCCCCAGGGAGCGGGGTCCGCGAGCTGGGGGTGGGGCGCTGGGGCTTTGGGTTCCCGCTCTGCCTAACCCCACCAGGGCGAGTCTGTGTACGCCGTTGTGTTGGTGGAGGAGGCAGGTGCCTGCAGACGCGCCTGAGGCTCTCCCCACCGGATCGGAAGCGTGGCCCACGGCCTGGCTCTCAGTAGGCCTCTGCCCGCAAGCAAGTGAGAAATGAGCGTCCGGCCGAGGGAAGGCGGCGGGTGGGGGCAGCGAGGTCTATAGGGGGTCTGGAGGTGCCTTCACGCTCTATCTCAGGCCACCCAACGGCCCTTCTAGGCCTGTGTTAGCCTCATGTTAGGGATGAAGAACAGAAGCCGAAACGTTAAGTGACTTGCTCAGAGTCCCACCGCGAGGAAGAACCAGCCCAGCCTTTTGCAGACTCTAGACGTCCCCGCCCCTGCCCGCGGTGGGATCTGAGCCAAGGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTT