Transcript asmbl_73803

Sequence
Transcript Sequence for observation asmbl_73803 of TGE0056566:
CCGAAAGCGCTGGGATTACAGGCGTGAGCCACCGCGCCCGGCCCTCCCTCTAGATTTTAAACCTGGGGGCACCGCAGCGGGCGTCTCCTCCCGCCCTCCCCCGCCTCTGTCCGAGACGCCGCCATTCCCCCTCCCCCGCTCCCACTCCCCCACCAGCTGGTGCCCCCGCTCGGGGGTCCCCAGGGCCGCCGCTCCGGCCGGGTTGTTGCAGTGACGAGCCTTCCCCGCAAGGATCCGGCCCGCACCTGCCGCAGCCTCGCCCTCTCCCCAGGGAGCGGGGTCCGCGAGCTGGGGGTGGGGCGCTGGGGCTTTGGGTTCCCGCTCTGCCTAACCCCACCAGGGCGAGTCTGTGTACGCCGTTGTGTTGGTGGAGGAGGCAGGTGCCTGCAGACGCGCCTGAGGCTCTCCCCACCGGATCGGAAGCGTGGCCCACGGCCTGGCTCTCAGTAGGCCTCTGCCCGCAAGCAAGCCTGTGTTAGCCTCATGTTAGGGATGAAGAACAGAAGCCGAAACGTTAAGTGACTTGCTCAGAGTCCCACCGCGAGGAAGAACCAGCCCAGCCTTTTGCAGACTCTAGACGTCCCCGCCCCTGCCCGCGGTGGGATCTGAGCCAAGGCCCTGGGCAGTGACGGGGTTCGGGTGACCATGGAGAGTGCGCTCACCGCCCGTGACCGGGTGGGGGTGCAGGATTTCGTGCTGCTGGAGAACTTCACCAGCGAGGCCGCCTTCATCGAGAACCTGCGGCGGCGATTTCGGGAGAATCTCATCTACACCTACATTGGCCCCGTCCTGGTCTCTGTCAATCCCTACCGGGACCTGCAGATCTACAGCCGGCAGCATATGGAGCGTTACCGTGGCGTCAGCTTCTATGAAGTGCCCCCTCACCTGTTTGCCGTGGCGGACACTGTGTACCGAGCACTGCGCACGGAGCGTCGGGACCAGGCTGTGATGATCTCTGGGGAGAGCGGGGCAGGCAAGACCGAGGCCACCAAGAGGCTGCTGCAGTTCTATGCAGAGACCTGCCCAGCCCCCGAGCGCGGAGGTGCCGTGCGGGACCGGCTGCTACAGAGCAACCCGGTGCTGGAGGCCTTTGGAAATGCCAAGACCCTCCGGAACGATAACTCCAGCAGGTTCGGGAAGTACATGGATGTGCAGTTTGACTTCAAGGGTGCCCCCGTGGGTGGCCACATCCTCAGTTACCTCCTGGAAAAGTCACGAGTGGTGCACCAGAATCATGGGGAGCGGAACTTCCACATCTTCTACCAGCTGCTGGAGGGGGGCGAGGAGGAGACTCTTCGCAGGCTGGGCTTGGAACGGAACCCCCAGAGCTACCTGTACCTGGTGAAGGGCCAGTGTGCCAAAGTCTCCTCCATCAACGACAAGAGTGACTGGAAGGTCGTCAGGAAGGCTCTGACAGTCATTGATTTCACCGAGGATGAAGTGGAGGACCTGCTGAGCATCGTGGCCAGCGTCCTTCATTTGGGCAACATCCACTTTGCTGCCAACGAGGAGAGCAATGCCCAGGTCACCACCGAGAACCAGCTCAAGTATCTGACCAGGCTCCTCAGCGTGGAAGGCTCGACGCTGCGAGAAGCCCTGACACACAGGAAGATCATCGCCAAGGGGGAGGAGCTCCTGAGCCCGCTGAACCTGGAGCAGGCCGCGTACGCACGAGACGCCCTCGCCAAGGCTGTGTACAGCCGCACTTTTACCTGGCTCGTCGGGAAGATCAACAGGTCGCTGGCCTCCAAGGACGTGGAGAGCCCCAGCTGGCGGAGCACCACGGTTCTCGGGCTCCTGGATATTTATGGCTTTGAAGTGTTTCAGCATAACAGCTTTGAGCAGTTCTGCATCAATTACTGCAACGAGAAGCTGCAGCAGCTCTT