Transcript asmbl_73801

Sequence
Transcript Sequence for observation asmbl_73801 of TGE0056258:
CCTCCCCAACTGCTGGGATTACAGCCGTGAGCCACTGTGCCCGGCCTGGGGTGCACCTGGGCAGCTGGTTCCTGCTCCTGAGGCCCTTTCAGCAGGCAGAGGGCTTGGCTCAGGCCGGCAGCCATCTGCAGCTTCCTCCCTGTCACCCCCAGGCACAAGCTGGCTGACCAGCGGACCAGGAAATCTCTGGGCCGAGGGGAATTCCGCCTTCTGCACTATGCGGGGGAGGTGACCTACAGCGTGACCGGGTTTCTGGACAAAAACAATGACCTTCTCTTCCGGAACCTTAAGGAGACCATGTGTAGCTCAAAGAATCCCATTATGAGCCAGTGCTTTGACCGGAGCGAGCTCAGTGACAAGAAGCGGCCAGAGACGGTCGCCACCCAGTTCAAGATGAGCCTCCTGCAGCTGGTGGAGATCCTGCAGTCTAAGGAGCCCGCCTACGTCCGCTGCATCAAACCCAATGATGCCAAACAGCCCGGCCGCTTTGACGAGGTGCTGATCCGCCACCAGGTGAAGTACCTGGGGCTGTTGGAAAACCTGCGCGTGCGCAGAGCCGGCTTTGCCTATCGCCGCAAATACGAAGCTTTCCTGCAAAGGTACAAGTCACTGTGCCCAGAGACGTGGCCCACGTGGGCAGGACGGCCGCAGGATGGGGTGGCTGTGCTGGTCCGACACCTGGGCTACAAGCCAGAAGAGTACAAGATGGGCAGGACCAAGATCTTCATCCGCTTCCCCAAGACCCTGTTTGCCACAGAGGATGCCCTGGAGGTCCGGCGGCAGAGCCTGGCCACAAAGATCCAAGCTGCCTGGAGGGGCTTTCACTGGCGGCAGAAATTCCTCCGGGTGAAGAGATCAGCCATCTGCATCCAGTCGTGGTGGCGTGGAACACTGGGCCGGAGGAAGGCAGCCAAGAGGAAGTGGGCGGCACAGACCATCCGGCGGCTCATCCGAGGCTTCGTCCTGCGCCACGCCCCCCGCTGCCCCGAGAACGCCTTCTTCCTGGACCATGTGCGCACCTCTTTTTTGCTAAACCTGAGGCGGCAGCTGCCCCAGAATGTCCTGGACACCTCGTGGCCCACGCCCCCACCTGCCCTGCGTGAGGCCTCAGAGCTTCTGCGGGAGTTGTGCATAAAGAACATGGTGTGGAAATACTGCCGGAGTATCAGCCCTGAGTGGAAGCAGCAGCTGCAGCAGAAGGCCGTGGCTAGTGAGATCTTCAAGGGCAAGAAGGATAATTACCCTCAGAGTGTACCCAGGCTCTTCATCAGCACTCGGCTTGGTACAGATGAGATCAGCCCCCGAGTGCTGCAGGCCTTGGGCTCTGAGCCCATTCAGTATGCGGTGCCTGTTGTGAAATACGACCGCAAGGGCTACAAGCCTCGCTCCCGGCAGCTGCTGCTCACGCCCAACGCCGTCGTCATCGTGGAGGACGCCAAAGTCAAGCAGAGGATTGATTACGCCAACCTGACCGGAATCTCTGTCAGCAGCCTGAGCGACAGTCTTTTTGTGCTTCATGTACAGCGTGCGGACAATAAGCAAAAGGGAGATGTGGTGCTGCAGAGTGACCACGTGATTGAGACGCTGACCAAGACAGCCCTCAGTGCCAACCGCGTGAACAGCATCAACATCAACCAGGGCAGCATCACGTTTGCAGGGGGCCCCGGCAGGGATGGCACCATTGACTTCACACCCGGCTCGGAGCTGCTCATCACCAAGGCCAAGAACGGGCACCTGGCTGTGGTCGCCCCACGGCTGAATTCTCGGTGATAAAGGCGCCCACTGGACCCTCCCAACGCCCAATGCTTTGCTTTTCTCCTCCTCCCCTTCCCAGTTACCAAAGACTCGAACTTCCAGACAGGGACCCAGGGACACCCCGAAGCCCACCTGCAATCTCCCACCTCCTGCCCATCCCTCTCTTGAGGGAGCAGCAGGGGCCAGGAGCTACCCCAGGAGTGGGCCAGGCCGGGCCACAGCAATAGGAAAGCCAGGGCCAGAGCGAGCCATGCCAGCCCTACTGCCGATGCCAAATATTTGAGAGAAGGGAACTTTTGCTGAGGTTTTCTCTGAGGTTTTTTTGATGCTTTATAGGAAACTATTTTTTAAAAAAAGCCATTTCCCACCCAAGGACACAGTGGATGTGTTTTCCCTGACTCCAGCAGGGCAAGGAATGTAGCCGAGAGGTTGTGTGGGCTGGGCTCTGGTGCCCTCTTCCCTGGCCAGGACACCTCTCCTCCTGATTCCCTTGGCACCTTGTCTTTCTGTCTGTTTACCTGTCTCCCTGCCTGCCCATCTGCATCTTTTGCAGCCCACTCTGACTTCCATCTGGGGGCTGAGACCACCCTTGCCTGCCCCCTTCTTTCTGCCTTAAGAATGTCCTTTTAGGCTGGGCATGGTGGCTCACGCCTGTAA